Incidental Mutation 'R5952:Fezf1'
ID470942
Institutional Source Beutler Lab
Gene Symbol Fezf1
Ensembl Gene ENSMUSG00000029697
Gene NameFez family zinc finger 1
SynonymsZfp312-like, 3110069A13Rik, Fez
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location23245044-23248362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23247428 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 216 (V216A)
Ref Sequence ENSEMBL: ENSMUSP00000031709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031709]
Predicted Effect probably benign
Transcript: ENSMUST00000031709
AA Change: V216A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031709
Gene: ENSMUSG00000029697
AA Change: V216A

DomainStartEndE-ValueType
low complexity region 102 114 N/A INTRINSIC
ZnF_C2H2 260 282 1.58e-3 SMART
ZnF_C2H2 288 310 3.39e-3 SMART
ZnF_C2H2 316 338 1.38e-3 SMART
ZnF_C2H2 344 366 2.57e-3 SMART
ZnF_C2H2 372 394 2.53e-2 SMART
ZnF_C2H2 400 423 1.38e-3 SMART
low complexity region 441 467 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202489
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that belongs to the zinc finger double domain protein family. The encoded protein is thought to play a role in the embryonic migration of gonadotropin-releasing hormone neurons into the brain. Mutations in this gene are associated with hypogonadotropic hypogonadism-22 with anosmia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation of this gene display neonatal lethality, impaired olfactory bulb development and impaired olfactory bulb interneuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Fezf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fezf1 APN 6 23247843 missense possibly damaging 0.76
IGL02538:Fezf1 APN 6 23246558 missense probably damaging 1.00
IGL02983:Fezf1 APN 6 23247872 missense probably damaging 0.99
IGL03372:Fezf1 APN 6 23246910 missense probably damaging 1.00
R0494:Fezf1 UTSW 6 23246055 missense probably damaging 1.00
R0612:Fezf1 UTSW 6 23247029 missense probably damaging 1.00
R0836:Fezf1 UTSW 6 23246999 missense probably benign 0.01
R1930:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R1931:Fezf1 UTSW 6 23246907 missense probably damaging 1.00
R2103:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2104:Fezf1 UTSW 6 23247332 missense possibly damaging 0.55
R2233:Fezf1 UTSW 6 23246003 missense probably damaging 1.00
R3404:Fezf1 UTSW 6 23247284 missense probably benign 0.13
R3950:Fezf1 UTSW 6 23247420 nonsense probably null
R4209:Fezf1 UTSW 6 23246617 missense probably damaging 0.99
R4400:Fezf1 UTSW 6 23247710 missense probably benign 0.22
R4614:Fezf1 UTSW 6 23247858 missense possibly damaging 0.71
R5287:Fezf1 UTSW 6 23248011 missense probably benign
R5878:Fezf1 UTSW 6 23247581 missense possibly damaging 0.71
R5943:Fezf1 UTSW 6 23246949 nonsense probably null
R6663:Fezf1 UTSW 6 23247528 missense probably damaging 1.00
R7158:Fezf1 UTSW 6 23245790 missense probably benign
R7184:Fezf1 UTSW 6 23247836 missense probably benign 0.31
X0025:Fezf1 UTSW 6 23247909 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAGACTTGCCTTGCCGC -3'
(R):5'- TTGCCACTACAGCAGTACAAG -3'

Sequencing Primer
(F):5'- TTGCCGCAGACTTCACAAGTG -3'
(R):5'- TACAAGCTGGTAAGGCCGC -3'
Posted On2017-03-31