Incidental Mutation 'R5952:Epn1'
ID470947
Institutional Source Beutler Lab
Gene Symbol Epn1
Ensembl Gene ENSMUSG00000035203
Gene Nameepsin 1
SynonymsIbp1
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5952 (G1)
Quality Score88
Status Validated
Chromosome7
Chromosomal Location5080235-5098178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5093912 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 231 (R231H)
Ref Sequence ENSEMBL: ENSMUSP00000146638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000146317] [ENSMUST00000208634]
Predicted Effect probably damaging
Transcript: ENSMUST00000045277
AA Change: R231H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203
AA Change: R231H

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098845
AA Change: R231H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203
AA Change: R231H

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146317
SMART Domains Protein: ENSMUSP00000116571
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 90 7.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155436
Predicted Effect probably damaging
Transcript: ENSMUST00000208634
AA Change: R231H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.2410 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epsin protein family. The encoded protein binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Loss of function of this gene is associated with reduced tumor growth and progression in certain cancer types. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Epn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Epn1 APN 7 5095036 missense probably benign 0.19
IGL03126:Epn1 APN 7 5095685 missense probably benign 0.01
epsilon UTSW 7 5095048 missense probably benign
R1074:Epn1 UTSW 7 5095048 missense probably benign
R1365:Epn1 UTSW 7 5093370 missense probably benign 0.05
R1848:Epn1 UTSW 7 5089998 missense probably damaging 1.00
R2041:Epn1 UTSW 7 5083875 missense probably damaging 0.99
R2237:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2238:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2239:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R4255:Epn1 UTSW 7 5097638 missense probably damaging 1.00
R4324:Epn1 UTSW 7 5097211 missense probably benign 0.07
R4542:Epn1 UTSW 7 5093981 missense possibly damaging 0.63
R4703:Epn1 UTSW 7 5095148 missense probably damaging 0.99
R4740:Epn1 UTSW 7 5090013 missense probably damaging 1.00
R4845:Epn1 UTSW 7 5093909 missense possibly damaging 0.94
R5838:Epn1 UTSW 7 5097166 nonsense probably null
R6251:Epn1 UTSW 7 5095926 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095936 missense probably damaging 1.00
R6296:Epn1 UTSW 7 5090123 missense probably damaging 0.98
R6710:Epn1 UTSW 7 5097304 missense probably damaging 0.99
R6937:Epn1 UTSW 7 5089944 missense probably damaging 1.00
R7196:Epn1 UTSW 7 5093381 missense possibly damaging 0.68
R7420:Epn1 UTSW 7 5097688 missense possibly damaging 0.77
R7948:Epn1 UTSW 7 5089993 nonsense probably null
X0065:Epn1 UTSW 7 5095093 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCATCCTTTCCACAGCAC -3'
(R):5'- GCCTATCGAGAAAGCCACAG -3'

Sequencing Primer
(F):5'- AGCTCCAAGCCTCCTGC -3'
(R):5'- CCACAGTGGCAAGAAAGTCACATTG -3'
Posted On2017-03-31