Incidental Mutation 'R5952:Tacc1'
ID470953
Institutional Source Beutler Lab
Gene Symbol Tacc1
Ensembl Gene ENSMUSG00000065954
Gene Nametransforming, acidic coiled-coil containing protein 1
Synonyms4833447E04Rik, B230378H13Rik, Tacc1
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25154552-25256588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25181995 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 406 (L406I)
Ref Sequence ENSEMBL: ENSMUSP00000081043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084030] [ENSMUST00000084512] [ENSMUST00000209827] [ENSMUST00000210016] [ENSMUST00000210488] [ENSMUST00000210767] [ENSMUST00000210933] [ENSMUST00000211622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084030
AA Change: L406I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081043
Gene: ENSMUSG00000065954
AA Change: L406I

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
Pfam:TACC 569 769 3.6e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084512
SMART Domains Protein: ENSMUSP00000081560
Gene: ENSMUSG00000065954

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
Pfam:TACC 160 366 3.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209827
Predicted Effect probably benign
Transcript: ENSMUST00000210016
Predicted Effect probably benign
Transcript: ENSMUST00000210488
Predicted Effect probably benign
Transcript: ENSMUST00000210767
Predicted Effect probably benign
Transcript: ENSMUST00000210933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211584
Predicted Effect probably benign
Transcript: ENSMUST00000211622
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus may represent a breast cancer candidate gene. It is located close to FGFR1 on a region of chromosome 8 that is amplified in some breast cancers. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Tacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Tacc1 APN 8 25175217 missense probably damaging 1.00
IGL02273:Tacc1 APN 8 25159781 missense probably damaging 1.00
IGL02728:Tacc1 APN 8 25175219 missense probably damaging 1.00
IGL02738:Tacc1 APN 8 25201143 missense probably damaging 1.00
R0194:Tacc1 UTSW 8 25182376 missense probably benign 0.45
R0617:Tacc1 UTSW 8 25178004 splice site probably benign
R1469:Tacc1 UTSW 8 25182255 missense probably benign 0.00
R1469:Tacc1 UTSW 8 25182255 missense probably benign 0.00
R1785:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R1786:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R1889:Tacc1 UTSW 8 25175253 missense probably damaging 0.99
R2131:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R2133:Tacc1 UTSW 8 25164493 missense probably damaging 1.00
R2419:Tacc1 UTSW 8 25182813 missense possibly damaging 0.90
R4740:Tacc1 UTSW 8 25182565 missense possibly damaging 0.94
R4793:Tacc1 UTSW 8 25182389 missense possibly damaging 0.96
R4911:Tacc1 UTSW 8 25182606 missense possibly damaging 0.66
R5177:Tacc1 UTSW 8 25201221 missense probably damaging 1.00
R5320:Tacc1 UTSW 8 25181865 missense probably benign 0.31
R5377:Tacc1 UTSW 8 25182283 missense possibly damaging 0.94
R5452:Tacc1 UTSW 8 25164415 missense probably null 1.00
R5930:Tacc1 UTSW 8 25182199 missense probably benign
R6767:Tacc1 UTSW 8 25240800 start codon destroyed probably null
R7200:Tacc1 UTSW 8 25241640 unclassified probably benign
R7464:Tacc1 UTSW 8 25164464 missense probably damaging 1.00
R7521:Tacc1 UTSW 8 25175252 missense possibly damaging 0.82
R7599:Tacc1 UTSW 8 25201285 start codon destroyed probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTGCCAAACTCCCAGAG -3'
(R):5'- TGGCACCCAGTATACGAAAAG -3'

Sequencing Primer
(F):5'- CCGATGTCACTCACGTACG -3'
(R):5'- CCCAGTATACGAAAAGATGGCGTC -3'
Posted On2017-03-31