Incidental Mutation 'R5952:Olfr56'
ID470961
Institutional Source Beutler Lab
Gene Symbol Olfr56
Ensembl Gene ENSMUSG00000040328
Gene Nameolfactory receptor 56
SynonymsIF7, MOR276-1, GA_x6K02T2QP88-6300500-6299553
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location48978889-49135387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49134572 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 95 (I95F)
Ref Sequence ENSEMBL: ENSMUSP00000136647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810]
Predicted Effect probably damaging
Transcript: ENSMUST00000056759
AA Change: I95F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328
AA Change: I95F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102785
AA Change: I95F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328
AA Change: I95F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179282
AA Change: I95F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328
AA Change: I95F

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203149
AA Change: I127F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328
AA Change: I127F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203810
AA Change: I127F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328
AA Change: I127F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Olfr56
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4354001:Olfr56 UTSW 11 49134305 missense probably damaging 1.00
R0200:Olfr56 UTSW 11 49135047 missense probably damaging 0.99
R0540:Olfr56 UTSW 11 49134722 missense probably damaging 1.00
R0607:Olfr56 UTSW 11 49134722 missense probably damaging 1.00
R4877:Olfr56 UTSW 11 49134781 missense probably damaging 1.00
R5027:Olfr56 UTSW 11 49134624 missense probably benign 0.35
R5598:Olfr56 UTSW 11 49135114 missense probably benign 0.00
R6191:Olfr56 UTSW 11 49135050 missense probably damaging 1.00
R6475:Olfr56 UTSW 11 49134933 missense probably benign 0.01
R6565:Olfr56 UTSW 11 49134812 missense probably damaging 0.99
R6807:Olfr56 UTSW 11 49134978 missense probably damaging 1.00
R7228:Olfr56 UTSW 11 49134879 missense possibly damaging 0.52
R7792:Olfr56 UTSW 11 49134669 missense possibly damaging 0.95
R8255:Olfr56 UTSW 11 49134480 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGGAAATGTCCTCCTCATC -3'
(R):5'- GTAAAGCCGGCACTTCACAG -3'

Sequencing Primer
(F):5'- AGTCAGCTCTCCCTCATGGAC -3'
(R):5'- GAAGAAGTGATCTATATACCGTGAGC -3'
Posted On2017-03-31