Incidental Mutation 'R5952:Arid4a'
ID470966
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene NameAT rich interactive domain 4A (RBP1-like)
SynonymsRbbp1, A630067N03Rik
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71015990-71098592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71063206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 107 (D107G)
Ref Sequence ENSEMBL: ENSMUSP00000121319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]
Predicted Effect probably benign
Transcript: ENSMUST00000046305
AA Change: D429G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: D429G

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134718
Predicted Effect probably benign
Transcript: ENSMUST00000135709
AA Change: D107G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: D107G

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71072593 missense probably damaging 1.00
IGL00546:Arid4a APN 12 71075671 missense probably benign
IGL00553:Arid4a APN 12 71075977 missense probably benign 0.04
IGL00708:Arid4a APN 12 71072728 missense probably benign 0.02
IGL00847:Arid4a APN 12 71075718 missense probably damaging 1.00
IGL01112:Arid4a APN 12 71072733 critical splice donor site probably null
IGL01456:Arid4a APN 12 71067262 missense probably benign 0.00
IGL01505:Arid4a APN 12 71037115 missense probably damaging 1.00
IGL01555:Arid4a APN 12 71061527 splice site probably benign
IGL01631:Arid4a APN 12 71022262 splice site probably benign
IGL02958:Arid4a APN 12 71097563 missense probably benign 0.01
IGL03087:Arid4a APN 12 71075245 missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71039966 missense probably damaging 1.00
IGL03234:Arid4a APN 12 71045060 missense probably benign 0.34
After_8 UTSW 12 71023498 critical splice acceptor site probably null
ariano UTSW 12 71069860 nonsense probably null
guava UTSW 12 71072632 missense probably damaging 0.99
limoncello UTSW 12 71067341 splice site probably null
Under_8 UTSW 12 71063206 missense probably benign 0.10
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0047:Arid4a UTSW 12 71075419 missense probably damaging 1.00
R0270:Arid4a UTSW 12 71072632 missense probably damaging 0.99
R0310:Arid4a UTSW 12 71075830 missense probably benign 0.05
R0504:Arid4a UTSW 12 71047214 missense probably damaging 1.00
R1061:Arid4a UTSW 12 71074955 missense probably damaging 1.00
R1087:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1169:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1171:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1531:Arid4a UTSW 12 71076005 missense probably benign 0.01
R1674:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1676:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1768:Arid4a UTSW 12 71075338 missense probably benign 0.01
R1833:Arid4a UTSW 12 71075466 missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71087589 missense probably damaging 1.00
R2290:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2292:Arid4a UTSW 12 71061541 missense probably damaging 1.00
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R2871:Arid4a UTSW 12 71022260 critical splice donor site probably null
R3411:Arid4a UTSW 12 71061525 splice site probably benign
R3768:Arid4a UTSW 12 71067119 missense probably damaging 1.00
R3838:Arid4a UTSW 12 71075785 missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71069995 missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71069964 missense probably damaging 1.00
R4829:Arid4a UTSW 12 71023498 critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71075947 missense probably damaging 0.96
R4952:Arid4a UTSW 12 71023525 missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71045079 missense probably benign 0.08
R5423:Arid4a UTSW 12 71069860 nonsense probably null
R5767:Arid4a UTSW 12 71060093 missense probably damaging 1.00
R5911:Arid4a UTSW 12 71069973 missense probably damaging 1.00
R6088:Arid4a UTSW 12 71022236 missense probably damaging 0.99
R6235:Arid4a UTSW 12 71069772 intron probably null
R6277:Arid4a UTSW 12 71039891 missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71075088 missense probably benign 0.04
R6523:Arid4a UTSW 12 71067341 splice site probably null
R6701:Arid4a UTSW 12 71087512 missense probably damaging 1.00
R6812:Arid4a UTSW 12 71047263 missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71017082 splice site probably null
R6837:Arid4a UTSW 12 71075515 missense probably benign
R6858:Arid4a UTSW 12 71023509 missense probably benign 0.01
R6895:Arid4a UTSW 12 71063302 missense probably benign 0.18
R6901:Arid4a UTSW 12 71067137 missense probably damaging 0.99
R6905:Arid4a UTSW 12 71061544 missense probably benign 0.43
R7387:Arid4a UTSW 12 71087496 missense probably damaging 1.00
R7570:Arid4a UTSW 12 71063142 nonsense probably null
R7772:Arid4a UTSW 12 71061589 missense possibly damaging 0.65
Z1176:Arid4a UTSW 12 71039920 missense possibly damaging 0.89
Z1177:Arid4a UTSW 12 71075637 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTCAGGTTTTACTACACATTTACC -3'
(R):5'- GACTGCTCTAATAACCTTGAAGC -3'

Sequencing Primer
(F):5'- TTTTGAGGAGTACTGCCG -3'
(R):5'- AGTATGCACATACATTAAAATGCCC -3'
Posted On2017-03-31