Incidental Mutation 'R5952:Spire1'
ID 470977
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Name spire type actin nucleation factor 1
Synonyms 6030430B19Rik, Spir-1
MMRRC Submission 044142-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R5952 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 67621279-67743860 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67639779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 245 (S245P)
Ref Sequence ENSEMBL: ENSMUSP00000049336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
AlphaFold Q52KF3
Predicted Effect probably benign
Transcript: ENSMUST00000045105
AA Change: S245P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: S245P

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082243
AA Change: S258P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: S258P

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115050
AA Change: S258P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: S258P

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224122
Predicted Effect probably benign
Transcript: ENSMUST00000224799
AA Change: S175P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A T 6: 86,086,728 (GRCm39) D296V probably damaging Het
Ak9 A G 10: 41,233,559 (GRCm39) E599G possibly damaging Het
Ank3 A T 10: 69,822,293 (GRCm39) I1604F probably benign Het
Arid4a A G 12: 71,109,980 (GRCm39) D107G probably benign Het
Bltp1 A G 3: 37,019,770 (GRCm39) T2060A probably damaging Het
Btn2a2 A T 13: 23,666,978 (GRCm39) I209N probably benign Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Csmd3 A G 15: 47,596,901 (GRCm39) V1979A probably damaging Het
Cyp4a12b C T 4: 115,271,714 (GRCm39) R142* probably null Het
Ddx23 A T 15: 98,556,121 (GRCm39) S66T unknown Het
Efcab2 A G 1: 178,303,439 (GRCm39) K121R probably benign Het
Epb41l1 T A 2: 156,345,708 (GRCm39) V237D probably damaging Het
Epb41l1 G T 2: 156,366,903 (GRCm39) A579S probably benign Het
Epn1 G A 7: 5,096,911 (GRCm39) R231H probably damaging Het
Fbrs T C 7: 127,086,924 (GRCm39) S649P probably damaging Het
Fezf1 A G 6: 23,247,427 (GRCm39) V216A probably benign Het
Gen1 A T 12: 11,310,897 (GRCm39) S112T probably damaging Het
Glrx2 A G 1: 143,620,872 (GRCm39) N84D probably benign Het
Gm1818 T G 12: 48,602,719 (GRCm39) noncoding transcript Het
Hira C A 16: 18,753,815 (GRCm39) T553K possibly damaging Het
Hnrnph3 A G 10: 62,851,374 (GRCm39) probably benign Het
Ighv12-3 A T 12: 114,330,204 (GRCm39) F97Y probably benign Het
Jcad A G 18: 4,674,554 (GRCm39) Q772R probably damaging Het
Lamb3 A G 1: 193,014,670 (GRCm39) T610A probably benign Het
Map3k19 T C 1: 127,750,477 (GRCm39) D958G probably benign Het
Map4k4 G A 1: 40,039,082 (GRCm39) probably benign Het
Mocos T C 18: 24,834,444 (GRCm39) V827A possibly damaging Het
Ms4a10 T A 19: 10,941,486 (GRCm39) D161V probably damaging Het
Myh9 A G 15: 77,657,532 (GRCm39) I1071T possibly damaging Het
Myo15a A G 11: 60,370,246 (GRCm39) E1002G possibly damaging Het
Neurod6 G A 6: 55,656,002 (GRCm39) H212Y probably damaging Het
Or2v1 A T 11: 49,025,399 (GRCm39) I95F probably damaging Het
Or52z13 T A 7: 103,247,174 (GRCm39) I217N probably damaging Het
Or5b12 T C 19: 12,897,194 (GRCm39) N160D probably benign Het
Pcdhb17 T C 18: 37,620,133 (GRCm39) V641A probably benign Het
Ppp3ca A T 3: 136,634,332 (GRCm39) M431L probably benign Het
Ptprk A T 10: 28,461,671 (GRCm39) I69F probably damaging Het
Rab34 G T 11: 78,081,094 (GRCm39) probably benign Het
Rb1cc1 A G 1: 6,318,406 (GRCm39) N619S probably benign Het
Rnf169 T C 7: 99,574,840 (GRCm39) H585R probably damaging Het
Rps6kc1 A G 1: 190,617,617 (GRCm39) V129A probably benign Het
Siglecf C T 7: 43,005,351 (GRCm39) T437M probably benign Het
Slc25a2 T C 18: 37,771,335 (GRCm39) N65D probably benign Het
Sptb A T 12: 76,679,158 (GRCm39) M99K probably benign Het
Tacc1 G T 8: 25,672,011 (GRCm39) L406I possibly damaging Het
Tas2r140 T C 6: 40,468,476 (GRCm39) I102T probably benign Het
Trappc11 A T 8: 47,949,952 (GRCm39) probably null Het
Trbv11 A G 6: 41,084,153 (GRCm39) noncoding transcript Het
Trmt11 A G 10: 30,436,838 (GRCm39) Y301H probably benign Het
Tspo A G 15: 83,456,441 (GRCm39) T75A possibly damaging Het
Ttn T C 2: 76,710,569 (GRCm39) probably benign Het
Zfhx4 A G 3: 5,462,030 (GRCm39) Q1210R probably damaging Het
Zhx3 A T 2: 160,623,937 (GRCm39) Y77N probably damaging Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67,662,085 (GRCm39) missense probably damaging 1.00
IGL01639:Spire1 APN 18 67,678,738 (GRCm39) missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67,639,725 (GRCm39) missense probably benign 0.00
PIT4677001:Spire1 UTSW 18 67,624,435 (GRCm39) missense probably damaging 1.00
R0457:Spire1 UTSW 18 67,685,670 (GRCm39) missense probably damaging 0.98
R0531:Spire1 UTSW 18 67,624,375 (GRCm39) missense probably damaging 1.00
R0608:Spire1 UTSW 18 67,661,945 (GRCm39) missense probably damaging 0.99
R2098:Spire1 UTSW 18 67,636,536 (GRCm39) missense probably damaging 0.99
R2299:Spire1 UTSW 18 67,663,493 (GRCm39) missense probably damaging 1.00
R3028:Spire1 UTSW 18 67,624,417 (GRCm39) missense probably damaging 1.00
R3815:Spire1 UTSW 18 67,639,733 (GRCm39) missense probably benign 0.05
R4049:Spire1 UTSW 18 67,662,101 (GRCm39) splice site probably null
R4050:Spire1 UTSW 18 67,662,101 (GRCm39) splice site probably null
R4059:Spire1 UTSW 18 67,678,783 (GRCm39) missense probably damaging 0.98
R4109:Spire1 UTSW 18 67,630,287 (GRCm39) missense probably damaging 1.00
R4700:Spire1 UTSW 18 67,645,935 (GRCm39) missense probably benign 0.01
R4941:Spire1 UTSW 18 67,652,384 (GRCm39) missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67,685,849 (GRCm39) splice site probably null
R5363:Spire1 UTSW 18 67,639,625 (GRCm39) missense probably damaging 1.00
R5561:Spire1 UTSW 18 67,639,716 (GRCm39) missense probably damaging 0.96
R5795:Spire1 UTSW 18 67,628,265 (GRCm39) missense probably benign
R5982:Spire1 UTSW 18 67,630,386 (GRCm39) critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67,652,950 (GRCm39) missense probably damaging 1.00
R7559:Spire1 UTSW 18 67,634,187 (GRCm39) missense probably benign 0.04
R8006:Spire1 UTSW 18 67,634,251 (GRCm39) nonsense probably null
R8111:Spire1 UTSW 18 67,652,391 (GRCm39) missense probably damaging 0.98
R8675:Spire1 UTSW 18 67,624,378 (GRCm39) missense possibly damaging 0.48
R8946:Spire1 UTSW 18 67,629,686 (GRCm39) missense probably damaging 1.00
R9441:Spire1 UTSW 18 67,652,462 (GRCm39) missense probably benign 0.41
R9706:Spire1 UTSW 18 67,636,508 (GRCm39) missense probably benign 0.39
T0970:Spire1 UTSW 18 67,634,133 (GRCm39) splice site probably null
Z1088:Spire1 UTSW 18 67,628,222 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCTCCGATCTTACCTTCACAG -3'
(R):5'- TTCCTAGAGCTCTGAGTTCTGAG -3'

Sequencing Primer
(F):5'- TACCTTCACAGACTGGAACTTAGAG -3'
(R):5'- CTCTGAGTTCTGAGCTACAAATGTG -3'
Posted On 2017-03-31