Incidental Mutation 'R5952:Ms4a10'
ID470978
Institutional Source Beutler Lab
Gene Symbol Ms4a10
Ensembl Gene ENSMUSG00000024731
Gene Namemembrane-spanning 4-domains, subfamily A, member 10
Synonyms2010001N17Rik
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10962293-10974670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10964122 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 161 (D161V)
Ref Sequence ENSEMBL: ENSMUSP00000140111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072748] [ENSMUST00000190246] [ENSMUST00000191343]
Predicted Effect probably damaging
Transcript: ENSMUST00000072748
AA Change: D201V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072531
Gene: ENSMUSG00000024731
AA Change: D201V

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 56 190 6e-10 PFAM
low complexity region 239 252 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190246
AA Change: D73V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140826
Gene: ENSMUSG00000024731
AA Change: D73V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191343
AA Change: D161V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140111
Gene: ENSMUSG00000024731
AA Change: D161V

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 57 150 7.9e-14 PFAM
low complexity region 199 212 N/A INTRINSIC
Meta Mutation Damage Score 0.5247 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Most MS4A genes, including MS4A10, encode proteins with at least 4 potential transmembrane domains and N- and C-terminal cytoplasmic domains encoded by distinct exons.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Ms4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Ms4a10 APN 19 10963010 missense probably benign
IGL03031:Ms4a10 APN 19 10968671 missense probably benign 0.01
P0027:Ms4a10 UTSW 19 10964128 missense probably damaging 0.99
R0863:Ms4a10 UTSW 19 10968593 missense probably damaging 1.00
R1456:Ms4a10 UTSW 19 10964733 missense possibly damaging 0.91
R1509:Ms4a10 UTSW 19 10964108 missense probably benign 0.01
R1838:Ms4a10 UTSW 19 10964047 missense possibly damaging 0.92
R4583:Ms4a10 UTSW 19 10968189 missense possibly damaging 0.94
R4932:Ms4a10 UTSW 19 10964768 missense probably damaging 1.00
R5548:Ms4a10 UTSW 19 10968120 critical splice donor site probably null
R5819:Ms4a10 UTSW 19 10968690 missense probably benign 0.00
R7026:Ms4a10 UTSW 19 10967505 intron probably null
R8063:Ms4a10 UTSW 19 10964772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCATGGTAACTTCCTTTCG -3'
(R):5'- ACAGGACTCTGGAGCAGAAC -3'

Sequencing Primer
(F):5'- CTTTCGAAGATCTGTGGAGCCC -3'
(R):5'- GACTCTGGAGCAGAACTAGAACTC -3'
Posted On2017-03-31