Incidental Mutation 'R5952:Olfr1448'
ID470979
Institutional Source Beutler Lab
Gene Symbol Olfr1448
Ensembl Gene ENSMUSG00000048456
Gene Nameolfactory receptor 1448
SynonymsMOR202-5, GA_x6K02T2RE5P-3249780-3248836
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12916661-12924419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12919830 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 160 (N160D)
Ref Sequence ENSEMBL: ENSMUSP00000149296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054737] [ENSMUST00000213177] [ENSMUST00000213713] [ENSMUST00000216888]
Predicted Effect probably benign
Transcript: ENSMUST00000054737
AA Change: N160D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055664
Gene: ENSMUSG00000048456
AA Change: N160D

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.2e-54 PFAM
Pfam:7tm_1 39 288 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208769
Predicted Effect probably benign
Transcript: ENSMUST00000213177
AA Change: N160D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000213713
AA Change: N160D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216888
AA Change: N160D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Olfr1448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1448 APN 19 12920126 missense probably damaging 1.00
IGL01730:Olfr1448 APN 19 12919562 missense probably damaging 1.00
IGL01901:Olfr1448 APN 19 12919583 missense probably damaging 0.98
IGL02055:Olfr1448 APN 19 12919566 missense possibly damaging 0.78
R0152:Olfr1448 UTSW 19 12920108 missense possibly damaging 0.49
R0311:Olfr1448 UTSW 19 12920096 missense possibly damaging 0.91
R0349:Olfr1448 UTSW 19 12919935 missense probably damaging 1.00
R1873:Olfr1448 UTSW 19 12919488 missense probably damaging 1.00
R2371:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R3548:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R4697:Olfr1448 UTSW 19 12919934 missense probably damaging 0.99
R5482:Olfr1448 UTSW 19 12919905 missense probably damaging 0.96
R5748:Olfr1448 UTSW 19 12920015 missense probably damaging 1.00
R5749:Olfr1448 UTSW 19 12920225 missense probably benign 0.02
R5795:Olfr1448 UTSW 19 12919824 missense possibly damaging 0.95
R6228:Olfr1448 UTSW 19 12919937 missense probably damaging 1.00
R6273:Olfr1448 UTSW 19 12919400 missense probably benign 0.02
R6341:Olfr1448 UTSW 19 12919479 missense probably benign 0.29
R6343:Olfr1448 UTSW 19 12919582 missense probably damaging 1.00
R6454:Olfr1448 UTSW 19 12920031 missense probably benign 0.10
R7666:Olfr1448 UTSW 19 12920162 missense probably damaging 0.99
R7810:Olfr1448 UTSW 19 12919865 missense probably benign 0.01
R7859:Olfr1448 UTSW 19 12919982 missense probably damaging 1.00
R7869:Olfr1448 UTSW 19 12919547 missense probably benign 0.26
R7942:Olfr1448 UTSW 19 12919982 missense probably damaging 1.00
R7952:Olfr1448 UTSW 19 12919547 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTTGTGGCGTCCTTCAGATG -3'
(R):5'- TCTTCGTGGGCTTTATAACCAC -3'

Sequencing Primer
(F):5'- TGAACGCATCCTCAGAATAGTG -3'
(R):5'- ACAGAAAGCTTTCTCTTGGCTG -3'
Posted On2017-03-31