Incidental Mutation 'R5953:Plekhm3'
ID 470981
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Name pleckstrin homology domain containing, family M, member 3
Synonyms Plekhm1l, A230102O09Rik, 9430067K14Rik
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.242) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 64828279-64995983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64977054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 139 (E139K)
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000123225] [ENSMUST00000139649]
AlphaFold Q8BM47
Predicted Effect probably damaging
Transcript: ENSMUST00000097713
AA Change: E139K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344
AA Change: E139K

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123225
Predicted Effect probably damaging
Transcript: ENSMUST00000139649
AA Change: E139K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344
AA Change: E139K

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181350
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64,960,991 (GRCm39) missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64,961,407 (GRCm39) missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64,961,025 (GRCm39) nonsense probably null
IGL02724:Plekhm3 APN 1 64,834,276 (GRCm39) missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64,960,959 (GRCm39) missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64,977,206 (GRCm39) missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64,960,910 (GRCm39) missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64,976,940 (GRCm39) small deletion probably benign
R1467:Plekhm3 UTSW 1 64,932,041 (GRCm39) missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64,932,041 (GRCm39) missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64,976,976 (GRCm39) missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64,976,940 (GRCm39) small deletion probably benign
R2328:Plekhm3 UTSW 1 64,976,940 (GRCm39) small deletion probably benign
R2432:Plekhm3 UTSW 1 64,977,015 (GRCm39) missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64,976,940 (GRCm39) small deletion probably benign
R3023:Plekhm3 UTSW 1 64,976,940 (GRCm39) small deletion probably benign
R4496:Plekhm3 UTSW 1 64,900,395 (GRCm39) missense probably damaging 1.00
R4529:Plekhm3 UTSW 1 64,976,984 (GRCm39) missense probably benign 0.14
R4682:Plekhm3 UTSW 1 64,977,086 (GRCm39) missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64,977,078 (GRCm39) missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64,859,149 (GRCm39) missense probably damaging 1.00
R5553:Plekhm3 UTSW 1 64,961,045 (GRCm39) missense possibly damaging 0.89
R5583:Plekhm3 UTSW 1 64,977,145 (GRCm39) nonsense probably null
R6319:Plekhm3 UTSW 1 64,961,093 (GRCm39) missense probably benign 0.20
R6970:Plekhm3 UTSW 1 64,931,912 (GRCm39) missense possibly damaging 0.80
R7014:Plekhm3 UTSW 1 64,922,429 (GRCm39) missense probably damaging 1.00
R7408:Plekhm3 UTSW 1 64,977,143 (GRCm39) missense probably benign 0.02
R7570:Plekhm3 UTSW 1 64,977,065 (GRCm39) missense probably damaging 1.00
R7663:Plekhm3 UTSW 1 64,922,367 (GRCm39) missense probably damaging 0.98
R7719:Plekhm3 UTSW 1 64,960,901 (GRCm39) missense probably benign 0.33
R7894:Plekhm3 UTSW 1 64,960,874 (GRCm39) missense probably benign
R8808:Plekhm3 UTSW 1 64,922,355 (GRCm39) missense possibly damaging 0.96
R9069:Plekhm3 UTSW 1 64,960,802 (GRCm39) missense probably benign 0.02
R9296:Plekhm3 UTSW 1 64,961,639 (GRCm39) missense probably benign 0.11
R9788:Plekhm3 UTSW 1 64,961,422 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCTTGCTGGGTGAAGACAAC -3'
(R):5'- GGGGCATGAGGTACTTGGTAAC -3'

Sequencing Primer
(F):5'- CTTGCTGGGTGAAGACAACAGAAAAG -3'
(R):5'- CCACTGTAAGAGCAGGCTTTTAG -3'
Posted On 2017-03-31