Incidental Mutation 'R5953:S100a9'
ID470990
Institutional Source Beutler Lab
Gene Symbol S100a9
Ensembl Gene ENSMUSG00000056071
Gene NameS100 calcium binding protein A9 (calgranulin B)
Synonyms60B8Ag, GAGB, Cagb, p14, MRP14, BEE22, L1Ag
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location90692632-90695721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90692927 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 54 (K54M)
Ref Sequence ENSEMBL: ENSMUSP00000112843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069960] [ENSMUST00000117167]
Predicted Effect probably damaging
Transcript: ENSMUST00000069960
AA Change: K54M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070842
Gene: ENSMUSG00000056071
AA Change: K54M

DomainStartEndE-ValueType
Pfam:S_100 9 51 6.7e-23 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117167
AA Change: K54M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112843
Gene: ENSMUSG00000056071
AA Change: K54M

DomainStartEndE-ValueType
Pfam:S_100 9 52 5.2e-24 PFAM
low complexity region 102 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis. This antimicrobial protein exhibits antifungal and antibacterial activity. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal immune physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in S100a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:S100a9 APN 3 90692768 missense probably benign 0.23
IGL02343:S100a9 APN 3 90695224 missense probably damaging 1.00
R0748:S100a9 UTSW 3 90692891 missense possibly damaging 0.73
R4365:S100a9 UTSW 3 90692774 missense unknown
R5919:S100a9 UTSW 3 90695188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTGCCATGACTGTG -3'
(R):5'- AGATGGCAAAGTCCTAGTGC -3'

Sequencing Primer
(F):5'- CCATGACTGTGGCCATGC -3'
(R):5'- AAAGTCCTAGTGCCCACGG -3'
Posted On2017-03-31