Incidental Mutation 'R5953:Cym'
ID470991
Institutional Source Beutler Lab
Gene Symbol Cym
Ensembl Gene ENSMUSG00000046213
Gene Namechymosin
SynonymsLOC229697, Gm131
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107211293-107221732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107213467 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 274 (D274V)
Ref Sequence ENSEMBL: ENSMUSP00000029504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029504]
Predicted Effect probably damaging
Transcript: ENSMUST00000029504
AA Change: D274V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029504
Gene: ENSMUSG00000046213
AA Change: D274V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 19 45 1.5e-16 PFAM
Pfam:Asp 73 378 5.8e-110 PFAM
Pfam:TAXi_N 74 228 3.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Cym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Cym APN 3 107214285 missense probably damaging 0.97
IGL02480:Cym APN 3 107213522 missense probably benign 0.00
IGL03224:Cym APN 3 107218732 missense possibly damaging 0.69
R1466:Cym UTSW 3 107213458 missense probably damaging 1.00
R1466:Cym UTSW 3 107213458 missense probably damaging 1.00
R1753:Cym UTSW 3 107213425 missense possibly damaging 0.91
R1768:Cym UTSW 3 107213500 missense probably damaging 1.00
R1851:Cym UTSW 3 107218714 missense probably benign 0.20
R4093:Cym UTSW 3 107214266 missense probably benign 0.06
R4094:Cym UTSW 3 107214266 missense probably benign 0.06
R4114:Cym UTSW 3 107219749 missense probably damaging 1.00
R4583:Cym UTSW 3 107211402 missense probably damaging 1.00
R4782:Cym UTSW 3 107216097 missense possibly damaging 0.60
R5844:Cym UTSW 3 107219764 missense probably benign 0.02
R7133:Cym UTSW 3 107214214 missense probably damaging 1.00
R7298:Cym UTSW 3 107219693 missense probably benign 0.07
R7563:Cym UTSW 3 107214232 missense probably damaging 1.00
R8365:Cym UTSW 3 107212866 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATTGGCCACTTTTAACAAATGGGC -3'
(R):5'- TGGCGGTTCTAAGAAGAGGC -3'

Sequencing Primer
(F):5'- ACTTTTAACAAATGGGCTCACC -3'
(R):5'- CTCAAAGGAGGGATTTGGACTTCC -3'
Posted On2017-03-31