Mutagenetix > Incidental Mutations

Incidental Mutation 'R5953:Cntln'

List |< first << previous [record 10 of 41] next >> last >|

470992

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

043245-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.281) question?

Stock #

R5953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85049919 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 792 (H792Y)

Ref Sequence

ENSEMBL: ENSMUSP00000130491 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047023
AA Change: H792Y

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: H792Y

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169371
AA Change: H792Y

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: H792Y

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,361,018	S675T	probably damaging	Het
Acvr2a	T	C	2: 48,890,404	L212P	probably damaging	Het
Adamts14	T	C	10: 61,207,446	T751A	probably damaging	Het
Adgrf2	T	C	17: 42,710,338	N532D	probably damaging	Het
Asns	T	C	6: 7,682,285	E220G	probably benign	Het
Cd209d	A	T	8: 3,877,979		probably null	Het
Cenpp	T	C	13: 49,652,685	D2G	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Clec4a3	G	T	6: 122,969,492	V232L	probably benign	Het
Cobl	T	A	11: 12,256,220	T470S	probably benign	Het
Cym	T	A	3: 107,213,467	D274V	probably damaging	Het
Elac2	G	A	11: 64,999,223	C627Y	probably benign	Het
Emc7	T	A	2: 112,459,558	I111N	probably damaging	Het
Eya4	T	A	10: 23,151,973	Y310F	probably damaging	Het
Fam217b	C	T	2: 178,420,360	S39F	probably damaging	Het
Fam234b	G	T	6: 135,225,707	R353L	possibly damaging	Het
Focad	A	G	4: 88,229,335	I404V	probably benign	Het
Il1rl1	T	A	1: 40,442,673	D180E	probably benign	Het
Il2rb	A	T	15: 78,484,982	C256*	probably null	Het
Intu	A	C	3: 40,679,550	L404F	probably damaging	Het
Jmy	G	A	13: 93,499,116	T64M	possibly damaging	Het
Mpl	C	A	4: 118,454,510	S302I	possibly damaging	Het
Mpl	T	A	4: 118,454,511	S302C	probably damaging	Het
Muc2	G	T	7: 141,701,382	D241Y	probably damaging	Het
Nlrp3	C	T	11: 59,546,791	H99Y	probably benign	Het
Olfr1474	A	T	19: 13,471,368	I133F	possibly damaging	Het
Olfr812	C	G	10: 129,842,614	V143L	probably benign	Het
Pglyrp1	A	T	7: 18,890,313	I174F	probably damaging	Het
Pi4ka	A	T	16: 17,281,951	I1936N	probably damaging	Het
Plekhm3	C	T	1: 64,937,895	E139K	probably damaging	Het
Pomk	C	A	8: 25,983,048	L292F	probably damaging	Het
Ptpru	A	G	4: 131,776,837	I1103T	probably damaging	Het
Pygl	T	C	12: 70,219,627	D38G	probably damaging	Het
Rapsn	T	C	2: 91,041,963	V214A	probably benign	Het
S100a9	T	A	3: 90,692,927	K54M	probably damaging	Het
Sdk2	A	G	11: 113,793,744	Y1964H	probably damaging	Het
Slc17a5	T	C	9: 78,557,498	N331S	probably damaging	Het
Snx9	T	A	17: 5,908,402	C252S	probably damaging	Het
Snx9	G	T	17: 5,908,403	C252F	probably damaging	Het
Trem1	A	T	17: 48,237,192	M82L	probably benign	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7440:Cntln	UTSW	4	85063216	missense	possibly damaging	0.95
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAGAACAACTACTGAGGGTG -3'
(R):5'- TTAATGAGAGCCTTACCTGCC -3'

Sequencing Primer
(F):5'- CTACTGAGGGTGAGCAAAGATGTAG -3'
(R):5'- AGGTTCTCCACGTGGCTCATAAC -3'

Posted On

2017-03-31