Mutagenetix > Incidental Mutation

Incidental Mutation 'R5953:Focad'

470993

Institutional Source

Beutler Lab

Gene Symbol

Focad

Ensembl Gene

ENSMUSG00000038368

Gene Name

focadhesin

Synonyms

BC057079

MMRRC Submission

043245-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.524) question?

Stock #

R5953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88094629-88411011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88229335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 404 (I404V)

Ref Sequence

ENSEMBL: ENSMUSP00000124298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]

AlphaFold

A2AKG8

Predicted Effect

unknown
Transcript: ENSMUST00000097992
AA Change: I490V

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: I490V

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159342
AA Change: I404V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: I404V

Domain	Start	End	E-Value	Type
Pfam:DUF3730	20	250	5.8e-27	PFAM
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	403	633	2.8e-61	PFAM
low complexity region	871	883	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1114	1123	N/A	INTRINSIC
Pfam:DUF3028	1124	1712	N/A	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,361,018	S675T	probably damaging	Het
Acvr2a	T	C	2: 48,890,404	L212P	probably damaging	Het
Adamts14	T	C	10: 61,207,446	T751A	probably damaging	Het
Adgrf2	T	C	17: 42,710,338	N532D	probably damaging	Het
Asns	T	C	6: 7,682,285	E220G	probably benign	Het
Cd209d	A	T	8: 3,877,979		probably null	Het
Cenpp	T	C	13: 49,652,685	D2G	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Clec4a3	G	T	6: 122,969,492	V232L	probably benign	Het
Cntln	C	T	4: 85,049,919	H792Y	possibly damaging	Het
Cobl	T	A	11: 12,256,220	T470S	probably benign	Het
Cym	T	A	3: 107,213,467	D274V	probably damaging	Het
Elac2	G	A	11: 64,999,223	C627Y	probably benign	Het
Emc7	T	A	2: 112,459,558	I111N	probably damaging	Het
Eya4	T	A	10: 23,151,973	Y310F	probably damaging	Het
Fam217b	C	T	2: 178,420,360	S39F	probably damaging	Het
Fam234b	G	T	6: 135,225,707	R353L	possibly damaging	Het
Il1rl1	T	A	1: 40,442,673	D180E	probably benign	Het
Il2rb	A	T	15: 78,484,982	C256*	probably null	Het
Intu	A	C	3: 40,679,550	L404F	probably damaging	Het
Jmy	G	A	13: 93,499,116	T64M	possibly damaging	Het
Mpl	C	A	4: 118,454,510	S302I	possibly damaging	Het
Mpl	T	A	4: 118,454,511	S302C	probably damaging	Het
Muc2	G	T	7: 141,701,382	D241Y	probably damaging	Het
Nlrp3	C	T	11: 59,546,791	H99Y	probably benign	Het
Olfr1474	A	T	19: 13,471,368	I133F	possibly damaging	Het
Olfr812	C	G	10: 129,842,614	V143L	probably benign	Het
Pglyrp1	A	T	7: 18,890,313	I174F	probably damaging	Het
Pi4ka	A	T	16: 17,281,951	I1936N		Het
Plekhm3	C	T	1: 64,937,895	E139K	probably damaging	Het
Pomk	C	A	8: 25,983,048	L292F	probably damaging	Het
Ptpru	A	G	4: 131,776,837	I1103T	probably damaging	Het
Pygl	T	C	12: 70,219,627	D38G	probably damaging	Het
Rapsn	T	C	2: 91,041,963	V214A	probably benign	Het
S100a9	T	A	3: 90,692,927	K54M	probably damaging	Het
Sdk2	A	G	11: 113,793,744	Y1964H	probably damaging	Het
Slc17a5	T	C	9: 78,557,498	N331S	probably damaging	Het
Snx9	T	A	17: 5,908,402	C252S	probably damaging	Het
Snx9	G	T	17: 5,908,403	C252F	probably damaging	Het
Trem1	A	T	17: 48,237,192	M82L	probably benign	Het

Other mutations in Focad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Focad	APN	4	88357474	missense	unknown
IGL00562:Focad	APN	4	88348809	missense	unknown
IGL00563:Focad	APN	4	88348809	missense	unknown
IGL00900:Focad	APN	4	88129023	missense	probably damaging	0.99
IGL00984:Focad	APN	4	88344785	missense	unknown
IGL01016:Focad	APN	4	88392015	missense	possibly damaging	0.51
IGL01069:Focad	APN	4	88326146	missense	unknown
IGL01305:Focad	APN	4	88393547	missense	probably benign	0.32
IGL01409:Focad	APN	4	88342305	missense	unknown
IGL01447:Focad	APN	4	88326228	missense	unknown
IGL01521:Focad	APN	4	88410690	makesense	probably null
IGL01672:Focad	APN	4	88360590	critical splice donor site	probably null
IGL01739:Focad	APN	4	88370806	missense	unknown
IGL02082:Focad	APN	4	88230578	nonsense	probably null
IGL02139:Focad	APN	4	88129054	critical splice donor site	probably null
IGL02381:Focad	APN	4	88274090	splice site	probably benign
IGL02898:Focad	APN	4	88391997	missense	probably benign	0.02
certitude	UTSW	4	88178133	missense	probably damaging	1.00
impression	UTSW	4	88278242	missense	unknown
Microscope	UTSW	4	88342204	missense	unknown
Nuance	UTSW	4	88196846	intron	probably benign
Objective	UTSW	4	88401068	nonsense	probably null
ANU22:Focad	UTSW	4	88393547	missense	probably benign	0.32
R0025:Focad	UTSW	4	88408959	missense	probably benign	0.02
R0554:Focad	UTSW	4	88348889	missense	unknown
R0617:Focad	UTSW	4	88121288	unclassified	probably benign
R0688:Focad	UTSW	4	88274213	missense	unknown
R0746:Focad	UTSW	4	88397214	missense	possibly damaging	0.84
R0907:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1109:Focad	UTSW	4	88196747	intron	probably benign
R1136:Focad	UTSW	4	88326180	missense	unknown
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1412:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1453:Focad	UTSW	4	88357442	critical splice acceptor site	probably null
R1697:Focad	UTSW	4	88408988	missense	probably damaging	0.98
R1739:Focad	UTSW	4	88397891	missense	probably benign	0.05
R1767:Focad	UTSW	4	88357468	missense	unknown
R1827:Focad	UTSW	4	88229383	missense	probably benign	0.03
R1866:Focad	UTSW	4	88407165	missense	possibly damaging	0.92
R1867:Focad	UTSW	4	88178089	missense	probably damaging	0.99
R1929:Focad	UTSW	4	88342212	missense	unknown
R1929:Focad	UTSW	4	88397179	missense	probably benign	0.32
R1937:Focad	UTSW	4	88401081	start codon destroyed	probably null
R1989:Focad	UTSW	4	88232784	critical splice donor site	probably null
R2176:Focad	UTSW	4	88279244	missense	unknown
R2393:Focad	UTSW	4	88121330	missense	probably damaging	0.96
R2431:Focad	UTSW	4	88331027	missense	unknown
R3195:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3196:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3730:Focad	UTSW	4	88408925	missense	possibly damaging	0.52
R3772:Focad	UTSW	4	88336161	splice site	probably benign
R4391:Focad	UTSW	4	88185958	missense	probably damaging	1.00
R4491:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4492:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4703:Focad	UTSW	4	88342321	critical splice donor site	probably null
R4788:Focad	UTSW	4	88357469	missense	unknown
R4923:Focad	UTSW	4	88196846	intron	probably benign
R5026:Focad	UTSW	4	88344582	missense	unknown
R5122:Focad	UTSW	4	88407365	critical splice donor site	probably null
R5153:Focad	UTSW	4	88359884	missense	unknown
R5369:Focad	UTSW	4	88121373	splice site	probably benign
R5414:Focad	UTSW	4	88410702	utr 3 prime	probably benign
R5839:Focad	UTSW	4	88196846	intron	probably benign
R5916:Focad	UTSW	4	88357541	missense	unknown
R5991:Focad	UTSW	4	88401019	missense	possibly damaging	0.91
R6230:Focad	UTSW	4	88342204	missense	unknown
R6247:Focad	UTSW	4	88407140	missense	possibly damaging	0.92
R6324:Focad	UTSW	4	88401068	nonsense	probably null
R6543:Focad	UTSW	4	88279256	missense	unknown
R6639:Focad	UTSW	4	88278242	missense	unknown
R6802:Focad	UTSW	4	88274203	missense	unknown
R6802:Focad	UTSW	4	88344684	missense	unknown
R6866:Focad	UTSW	4	88403386	missense	probably benign	0.34
R6902:Focad	UTSW	4	88230476	missense	unknown
R6928:Focad	UTSW	4	88348875	missense	unknown
R7036:Focad	UTSW	4	88124637	missense	probably benign	0.05
R7057:Focad	UTSW	4	88274105	missense	unknown
R7077:Focad	UTSW	4	88410677	missense	unknown
R7242:Focad	UTSW	4	88309906	missense	unknown
R7357:Focad	UTSW	4	88229335	missense	probably benign	0.19
R7380:Focad	UTSW	4	88274198	missense	unknown
R7427:Focad	UTSW	4	88368751	missense	unknown
R7582:Focad	UTSW	4	88229378	missense	probably benign	0.00
R7661:Focad	UTSW	4	88303535	missense	unknown
R7688:Focad	UTSW	4	88178133	missense	probably damaging	1.00
R7789:Focad	UTSW	4	88229406	missense	unknown
R7880:Focad	UTSW	4	88401170	missense	unknown
R7887:Focad	UTSW	4	88182616	missense	probably damaging	1.00
R8024:Focad	UTSW	4	88397000	missense	unknown
R8129:Focad	UTSW	4	88232763	missense	unknown
R8369:Focad	UTSW	4	88232668	missense	unknown
R8837:Focad	UTSW	4	88154668	missense	probably damaging	0.96
R9014:Focad	UTSW	4	88357526	missense	unknown
R9282:Focad	UTSW	4	88196822	missense	unknown
R9431:Focad	UTSW	4	88403346	missense	unknown
R9435:Focad	UTSW	4	88348839	missense	unknown
R9676:Focad	UTSW	4	88355445	missense	unknown
X0035:Focad	UTSW	4	88397922	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GCTTAAGTGCTAACTGTCTGATTGAAC -3'
(R):5'- TGAAGTAGGAAGCAATACCCAC -3'

Sequencing Primer
(F):5'- GTGCTAACTGTCTGATTGAACTATAC -3'
(R):5'- CACCAAGTGTAGGCAAAG -3'

Posted On

2017-03-31