Incidental Mutation 'R5953:Focad'
ID 470993
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Name focadhesin
Synonyms BC057079
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.515) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 88012866-88329248 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88147572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 404 (I404V)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
AlphaFold A2AKG8
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: I490V
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: I490V

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159342
AA Change: I404V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: I404V

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88,275,711 (GRCm39) missense unknown
IGL00562:Focad APN 4 88,267,046 (GRCm39) missense unknown
IGL00563:Focad APN 4 88,267,046 (GRCm39) missense unknown
IGL00900:Focad APN 4 88,047,260 (GRCm39) missense probably damaging 0.99
IGL00984:Focad APN 4 88,263,022 (GRCm39) missense unknown
IGL01016:Focad APN 4 88,310,252 (GRCm39) missense possibly damaging 0.51
IGL01069:Focad APN 4 88,244,383 (GRCm39) missense unknown
IGL01305:Focad APN 4 88,311,784 (GRCm39) missense probably benign 0.32
IGL01409:Focad APN 4 88,260,542 (GRCm39) missense unknown
IGL01447:Focad APN 4 88,244,465 (GRCm39) missense unknown
IGL01521:Focad APN 4 88,328,927 (GRCm39) makesense probably null
IGL01672:Focad APN 4 88,278,827 (GRCm39) critical splice donor site probably null
IGL01739:Focad APN 4 88,289,043 (GRCm39) missense unknown
IGL02082:Focad APN 4 88,148,815 (GRCm39) nonsense probably null
IGL02139:Focad APN 4 88,047,291 (GRCm39) critical splice donor site probably null
IGL02381:Focad APN 4 88,192,327 (GRCm39) splice site probably benign
IGL02898:Focad APN 4 88,310,234 (GRCm39) missense probably benign 0.02
certitude UTSW 4 88,096,370 (GRCm39) missense probably damaging 1.00
impression UTSW 4 88,196,479 (GRCm39) missense unknown
Microscope UTSW 4 88,260,441 (GRCm39) missense unknown
Nuance UTSW 4 88,115,083 (GRCm39) intron probably benign
Objective UTSW 4 88,319,305 (GRCm39) nonsense probably null
ANU22:Focad UTSW 4 88,311,784 (GRCm39) missense probably benign 0.32
R0025:Focad UTSW 4 88,327,196 (GRCm39) missense probably benign 0.02
R0554:Focad UTSW 4 88,267,126 (GRCm39) missense unknown
R0617:Focad UTSW 4 88,039,525 (GRCm39) unclassified probably benign
R0688:Focad UTSW 4 88,192,450 (GRCm39) missense unknown
R0746:Focad UTSW 4 88,315,451 (GRCm39) missense possibly damaging 0.84
R0907:Focad UTSW 4 88,196,498 (GRCm39) critical splice donor site probably null
R1109:Focad UTSW 4 88,114,984 (GRCm39) intron probably benign
R1136:Focad UTSW 4 88,244,417 (GRCm39) missense unknown
R1185:Focad UTSW 4 88,096,424 (GRCm39) missense probably benign 0.40
R1185:Focad UTSW 4 88,096,424 (GRCm39) missense probably benign 0.40
R1185:Focad UTSW 4 88,096,424 (GRCm39) missense probably benign 0.40
R1412:Focad UTSW 4 88,196,498 (GRCm39) critical splice donor site probably null
R1453:Focad UTSW 4 88,275,679 (GRCm39) critical splice acceptor site probably null
R1697:Focad UTSW 4 88,327,225 (GRCm39) missense probably damaging 0.98
R1739:Focad UTSW 4 88,316,128 (GRCm39) missense probably benign 0.05
R1767:Focad UTSW 4 88,275,705 (GRCm39) missense unknown
R1827:Focad UTSW 4 88,147,620 (GRCm39) missense probably benign 0.03
R1866:Focad UTSW 4 88,325,402 (GRCm39) missense possibly damaging 0.92
R1867:Focad UTSW 4 88,096,326 (GRCm39) missense probably damaging 0.99
R1929:Focad UTSW 4 88,260,449 (GRCm39) missense unknown
R1929:Focad UTSW 4 88,315,416 (GRCm39) missense probably benign 0.32
R1937:Focad UTSW 4 88,319,318 (GRCm39) start codon destroyed probably null
R1989:Focad UTSW 4 88,151,021 (GRCm39) critical splice donor site probably null
R2176:Focad UTSW 4 88,197,481 (GRCm39) missense unknown
R2393:Focad UTSW 4 88,039,567 (GRCm39) missense probably damaging 0.96
R2431:Focad UTSW 4 88,249,264 (GRCm39) missense unknown
R3195:Focad UTSW 4 88,325,588 (GRCm39) missense possibly damaging 0.85
R3196:Focad UTSW 4 88,325,588 (GRCm39) missense possibly damaging 0.85
R3730:Focad UTSW 4 88,327,162 (GRCm39) missense possibly damaging 0.52
R3772:Focad UTSW 4 88,254,398 (GRCm39) splice site probably benign
R4391:Focad UTSW 4 88,104,195 (GRCm39) missense probably damaging 1.00
R4491:Focad UTSW 4 88,278,142 (GRCm39) critical splice donor site probably null
R4492:Focad UTSW 4 88,278,142 (GRCm39) critical splice donor site probably null
R4703:Focad UTSW 4 88,260,558 (GRCm39) critical splice donor site probably null
R4788:Focad UTSW 4 88,275,706 (GRCm39) missense unknown
R4923:Focad UTSW 4 88,115,083 (GRCm39) intron probably benign
R5026:Focad UTSW 4 88,262,819 (GRCm39) missense unknown
R5122:Focad UTSW 4 88,325,602 (GRCm39) critical splice donor site probably null
R5153:Focad UTSW 4 88,278,121 (GRCm39) missense unknown
R5369:Focad UTSW 4 88,039,610 (GRCm39) splice site probably benign
R5414:Focad UTSW 4 88,328,939 (GRCm39) utr 3 prime probably benign
R5839:Focad UTSW 4 88,115,083 (GRCm39) intron probably benign
R5916:Focad UTSW 4 88,275,778 (GRCm39) missense unknown
R5991:Focad UTSW 4 88,319,256 (GRCm39) missense possibly damaging 0.91
R6230:Focad UTSW 4 88,260,441 (GRCm39) missense unknown
R6247:Focad UTSW 4 88,325,377 (GRCm39) missense possibly damaging 0.92
R6324:Focad UTSW 4 88,319,305 (GRCm39) nonsense probably null
R6543:Focad UTSW 4 88,197,493 (GRCm39) missense unknown
R6639:Focad UTSW 4 88,196,479 (GRCm39) missense unknown
R6802:Focad UTSW 4 88,262,921 (GRCm39) missense unknown
R6802:Focad UTSW 4 88,192,440 (GRCm39) missense unknown
R6866:Focad UTSW 4 88,321,623 (GRCm39) missense probably benign 0.34
R6902:Focad UTSW 4 88,148,713 (GRCm39) missense unknown
R6928:Focad UTSW 4 88,267,112 (GRCm39) missense unknown
R7036:Focad UTSW 4 88,042,874 (GRCm39) missense probably benign 0.05
R7057:Focad UTSW 4 88,192,342 (GRCm39) missense unknown
R7077:Focad UTSW 4 88,328,914 (GRCm39) missense unknown
R7242:Focad UTSW 4 88,228,143 (GRCm39) missense unknown
R7357:Focad UTSW 4 88,147,572 (GRCm39) missense probably benign 0.19
R7380:Focad UTSW 4 88,192,435 (GRCm39) missense unknown
R7427:Focad UTSW 4 88,286,988 (GRCm39) missense unknown
R7582:Focad UTSW 4 88,147,615 (GRCm39) missense probably benign 0.00
R7661:Focad UTSW 4 88,221,772 (GRCm39) missense unknown
R7688:Focad UTSW 4 88,096,370 (GRCm39) missense probably damaging 1.00
R7789:Focad UTSW 4 88,147,643 (GRCm39) missense unknown
R7880:Focad UTSW 4 88,319,407 (GRCm39) missense unknown
R7887:Focad UTSW 4 88,100,853 (GRCm39) missense probably damaging 1.00
R8024:Focad UTSW 4 88,315,237 (GRCm39) missense unknown
R8129:Focad UTSW 4 88,151,000 (GRCm39) missense unknown
R8369:Focad UTSW 4 88,150,905 (GRCm39) missense unknown
R8837:Focad UTSW 4 88,072,905 (GRCm39) missense probably damaging 0.96
R9014:Focad UTSW 4 88,275,763 (GRCm39) missense unknown
R9282:Focad UTSW 4 88,115,059 (GRCm39) missense unknown
R9431:Focad UTSW 4 88,321,583 (GRCm39) missense unknown
R9435:Focad UTSW 4 88,267,076 (GRCm39) missense unknown
R9676:Focad UTSW 4 88,273,682 (GRCm39) missense unknown
X0035:Focad UTSW 4 88,316,159 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTTAAGTGCTAACTGTCTGATTGAAC -3'
(R):5'- TGAAGTAGGAAGCAATACCCAC -3'

Sequencing Primer
(F):5'- GTGCTAACTGTCTGATTGAACTATAC -3'
(R):5'- CACCAAGTGTAGGCAAAG -3'
Posted On 2017-03-31