Mutagenetix > Incidental Mutations

Incidental Mutation 'R5953:Ptpru'

List |< first << previous [record 33 of 41] next >> last >|

470996

Institutional Source

Beutler Lab

Gene Symbol

Ptpru

Ensembl Gene

ENSMUSG00000028909

Gene Name

protein tyrosine phosphatase, receptor type, U

Synonyms

Ptprl, RPTPlambda

MMRRC Submission

043245-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131768457-131838288 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 131776837 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1103 (I1103T)

Ref Sequence

ENSEMBL: ENSMUSP00000101607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030741
AA Change: I1113T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: I1113T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	747	769	N/A	INTRINSIC
PTPc	893	1146	5.95e-102	SMART
PTPc	1175	1441	3.67e-93	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105987
AA Change: I1103T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: I1103T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
MAM	22	188	5.58e-68	SMART
IG	195	283	4.93e-3	SMART
FN3	285	368	3.79e-2	SMART
FN3	384	472	2.5e-2	SMART
FN3	488	576	3.62e-8	SMART
low complexity region	627	641	N/A	INTRINSIC
low complexity region	667	677	N/A	INTRINSIC
transmembrane domain	748	770	N/A	INTRINSIC
PTPc	883	1136	5.95e-102	SMART
PTPc	1165	1431	3.67e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127633

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,361,018	S675T	probably damaging	Het
Acvr2a	T	C	2: 48,890,404	L212P	probably damaging	Het
Adamts14	T	C	10: 61,207,446	T751A	probably damaging	Het
Adgrf2	T	C	17: 42,710,338	N532D	probably damaging	Het
Asns	T	C	6: 7,682,285	E220G	probably benign	Het
Cd209d	A	T	8: 3,877,979		probably null	Het
Cenpp	T	C	13: 49,652,685	D2G	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Clec4a3	G	T	6: 122,969,492	V232L	probably benign	Het
Cntln	C	T	4: 85,049,919	H792Y	possibly damaging	Het
Cobl	T	A	11: 12,256,220	T470S	probably benign	Het
Cym	T	A	3: 107,213,467	D274V	probably damaging	Het
Elac2	G	A	11: 64,999,223	C627Y	probably benign	Het
Emc7	T	A	2: 112,459,558	I111N	probably damaging	Het
Eya4	T	A	10: 23,151,973	Y310F	probably damaging	Het
Fam217b	C	T	2: 178,420,360	S39F	probably damaging	Het
Fam234b	G	T	6: 135,225,707	R353L	possibly damaging	Het
Focad	A	G	4: 88,229,335	I404V	probably benign	Het
Il1rl1	T	A	1: 40,442,673	D180E	probably benign	Het
Il2rb	A	T	15: 78,484,982	C256*	probably null	Het
Intu	A	C	3: 40,679,550	L404F	probably damaging	Het
Jmy	G	A	13: 93,499,116	T64M	possibly damaging	Het
Mpl	C	A	4: 118,454,510	S302I	possibly damaging	Het
Mpl	T	A	4: 118,454,511	S302C	probably damaging	Het
Muc2	G	T	7: 141,701,382	D241Y	probably damaging	Het
Nlrp3	C	T	11: 59,546,791	H99Y	probably benign	Het
Olfr1474	A	T	19: 13,471,368	I133F	possibly damaging	Het
Olfr812	C	G	10: 129,842,614	V143L	probably benign	Het
Pglyrp1	A	T	7: 18,890,313	I174F	probably damaging	Het
Pi4ka	A	T	16: 17,281,951	I1936N	probably damaging	Het
Plekhm3	C	T	1: 64,937,895	E139K	probably damaging	Het
Pomk	C	A	8: 25,983,048	L292F	probably damaging	Het
Pygl	T	C	12: 70,219,627	D38G	probably damaging	Het
Rapsn	T	C	2: 91,041,963	V214A	probably benign	Het
S100a9	T	A	3: 90,692,927	K54M	probably damaging	Het
Sdk2	A	G	11: 113,793,744	Y1964H	probably damaging	Het
Slc17a5	T	C	9: 78,557,498	N331S	probably damaging	Het
Snx9	T	A	17: 5,908,402	C252S	probably damaging	Het
Snx9	G	T	17: 5,908,403	C252F	probably damaging	Het
Trem1	A	T	17: 48,237,192	M82L	probably benign	Het

Other mutations in Ptpru

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Ptpru	APN	4	131808235	missense	probably benign	0.00
IGL00966:Ptpru	APN	4	131772616	missense	probably damaging	1.00
IGL01451:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01453:Ptpru	APN	4	131769492	utr 3 prime	probably benign
IGL01606:Ptpru	APN	4	131808481	missense	possibly damaging	0.69
IGL02451:Ptpru	APN	4	131776775	splice site	probably benign
IGL03135:Ptpru	APN	4	131818800	missense	probably damaging	0.97
IGL03366:Ptpru	APN	4	131779867	missense	probably damaging	1.00
PIT4366001:Ptpru	UTSW	4	131799712	missense	probably benign	0.03
PIT4576001:Ptpru	UTSW	4	131802544	nonsense	probably null
R0299:Ptpru	UTSW	4	131803387	nonsense	probably null
R0458:Ptpru	UTSW	4	131799675	missense	possibly damaging	0.49
R0502:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0503:Ptpru	UTSW	4	131793643	missense	probably benign	0.02
R0619:Ptpru	UTSW	4	131820887	missense	possibly damaging	0.91
R0639:Ptpru	UTSW	4	131771179	missense	possibly damaging	0.49
R0843:Ptpru	UTSW	4	131797948	missense	probably benign	0.10
R1065:Ptpru	UTSW	4	131808340	missense	possibly damaging	0.49
R1170:Ptpru	UTSW	4	131808527	splice site	probably benign
R1382:Ptpru	UTSW	4	131808229	missense	probably damaging	0.98
R1442:Ptpru	UTSW	4	131808269	missense	probably benign	0.00
R1538:Ptpru	UTSW	4	131774351	missense	probably damaging	0.99
R1624:Ptpru	UTSW	4	131772550	missense	probably damaging	1.00
R1688:Ptpru	UTSW	4	131787345	missense	probably benign	0.01
R1699:Ptpru	UTSW	4	131779050	missense	probably damaging	1.00
R1740:Ptpru	UTSW	4	131793678	splice site	probably null
R1874:Ptpru	UTSW	4	131769755	missense	probably benign
R1959:Ptpru	UTSW	4	131803477	missense	probably damaging	1.00
R2051:Ptpru	UTSW	4	131819087	missense	possibly damaging	0.80
R2200:Ptpru	UTSW	4	131820813	missense	probably damaging	1.00
R2281:Ptpru	UTSW	4	131808499	missense	probably damaging	1.00
R2304:Ptpru	UTSW	4	131772568	missense	probably damaging	1.00
R2411:Ptpru	UTSW	4	131771469	missense	probably damaging	1.00
R2845:Ptpru	UTSW	4	131819661	missense	probably benign	0.00
R3767:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3768:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3769:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3770:Ptpru	UTSW	4	131808424	missense	probably damaging	1.00
R3937:Ptpru	UTSW	4	131774304	missense	probably damaging	0.99
R4079:Ptpru	UTSW	4	131798710	critical splice donor site	probably null
R4110:Ptpru	UTSW	4	131819037	missense	probably damaging	1.00
R4170:Ptpru	UTSW	4	131776348	missense	probably damaging	1.00
R4716:Ptpru	UTSW	4	131820968	missense	probably benign
R4751:Ptpru	UTSW	4	131802586	missense	probably damaging	0.97
R4766:Ptpru	UTSW	4	131820964	missense	probably damaging	1.00
R4825:Ptpru	UTSW	4	131799603	missense	probably benign
R4900:Ptpru	UTSW	4	131788382	missense	probably damaging	0.99
R4998:Ptpru	UTSW	4	131776885	missense	probably damaging	1.00
R5279:Ptpru	UTSW	4	131820023	missense	possibly damaging	0.62
R5464:Ptpru	UTSW	4	131772557	missense	probably damaging	1.00
R5625:Ptpru	UTSW	4	131803380	missense	probably null	1.00
R5667:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5671:Ptpru	UTSW	4	131820190	missense	possibly damaging	0.94
R5735:Ptpru	UTSW	4	131838090	missense	probably benign	0.01
R5802:Ptpru	UTSW	4	131788377	missense	possibly damaging	0.84
R5809:Ptpru	UTSW	4	131785756	missense	probably benign	0.34
R5973:Ptpru	UTSW	4	131818925	missense	probably benign	0.00
R6029:Ptpru	UTSW	4	131771293	missense	probably damaging	1.00
R6072:Ptpru	UTSW	4	131776228	missense	probably damaging	0.99
R6089:Ptpru	UTSW	4	131772630	missense	possibly damaging	0.94
R6174:Ptpru	UTSW	4	131785754	missense	probably benign
R6177:Ptpru	UTSW	4	131793525	missense	probably benign	0.00
R6367:Ptpru	UTSW	4	131774352	missense	probably benign	0.18
R6682:Ptpru	UTSW	4	131820782	missense	probably benign
R6950:Ptpru	UTSW	4	131776352	missense	probably damaging	0.99
R7159:Ptpru	UTSW	4	131819540	missense	probably damaging	1.00
R7736:Ptpru	UTSW	4	131788382	missense	probably damaging	1.00
R7960:Ptpru	UTSW	4	131788509	missense	probably benign	0.01
R8094:Ptpru	UTSW	4	131793592	missense	possibly damaging	0.88
R8262:Ptpru	UTSW	4	131794963	nonsense	probably null
R8276:Ptpru	UTSW	4	131779173	missense	probably damaging	1.00
R8355:Ptpru	UTSW	4	131808500	missense	probably damaging	1.00
R8377:Ptpru	UTSW	4	131808335	missense	probably damaging	1.00
R8416:Ptpru	UTSW	4	131808472	missense	probably damaging	1.00
X0024:Ptpru	UTSW	4	131771190	missense	probably benign	0.15
Z1177:Ptpru	UTSW	4	131799706	missense	probably benign	0.00
Z1177:Ptpru	UTSW	4	131808262	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACGACACTGAAATGAAGTTTGG -3'
(R):5'- TAGCTATGGCAGACACCCTG -3'

Sequencing Primer
(F):5'- TTTGGAGAGACCTAAGAGCCACC -3'
(R):5'- AGACACCCTGGTCCCTG -3'

Posted On

2017-03-31