Incidental Mutation 'R5953:Asns'
ID 470998
Institutional Source Beutler Lab
Gene Symbol Asns
Ensembl Gene ENSMUSG00000029752
Gene Name asparagine synthetase
Synonyms
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.272) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 7675169-7693209 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7682285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 220 (E220G)
Ref Sequence ENSEMBL: ENSMUSP00000115415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542] [ENSMUST00000126303] [ENSMUST00000139596] [ENSMUST00000148349]
AlphaFold Q61024
Predicted Effect probably benign
Transcript: ENSMUST00000031766
AA Change: E220G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: E220G

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 4.3e-21 PFAM
Pfam:GATase_7 47 166 9.1e-26 PFAM
Pfam:DUF3700 68 178 5.5e-6 PFAM
Pfam:GATase_2 91 161 3.3e-5 PFAM
Pfam:Asn_synthase 234 467 1.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115542
AA Change: E220G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: E220G

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 1.2e-19 PFAM
Pfam:GATase_7 47 166 4.8e-25 PFAM
Pfam:DUF3700 64 180 3.3e-6 PFAM
Pfam:Asn_synthase 234 390 2.4e-46 PFAM
Pfam:Asn_synthase 382 547 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126303
AA Change: E220G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115415
Gene: ENSMUSG00000029752
AA Change: E220G

DomainStartEndE-ValueType
Pfam:GATase_6 28 160 1.3e-24 PFAM
Pfam:GATase_7 47 166 3.1e-29 PFAM
Pfam:DUF3700 67 180 6.3e-10 PFAM
Pfam:GATase_2 89 161 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133972
Predicted Effect probably benign
Transcript: ENSMUST00000139596
SMART Domains Protein: ENSMUSP00000120489
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 26 157 7e-25 PFAM
Pfam:GATase_7 47 157 1e-27 PFAM
Pfam:DUF3700 66 158 5.7e-9 PFAM
Pfam:GATase_2 89 158 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140097
Predicted Effect probably benign
Transcript: ENSMUST00000148349
SMART Domains Protein: ENSMUSP00000118003
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 24 127 1.4e-17 PFAM
Pfam:GATase_7 47 127 2.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Asns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Asns APN 6 7,680,179 (GRCm39) missense probably damaging 1.00
IGL00656:Asns APN 6 7,680,215 (GRCm39) unclassified probably benign
IGL01534:Asns APN 6 7,675,397 (GRCm39) missense probably benign 0.03
IGL01996:Asns APN 6 7,682,378 (GRCm39) missense possibly damaging 0.56
IGL02058:Asns APN 6 7,685,184 (GRCm39) missense probably damaging 1.00
IGL02311:Asns APN 6 7,676,233 (GRCm39) critical splice donor site probably null
IGL02367:Asns APN 6 7,685,411 (GRCm39) splice site probably benign
IGL03263:Asns APN 6 7,689,404 (GRCm39) missense probably benign 0.07
IGL03341:Asns APN 6 7,682,002 (GRCm39) missense probably damaging 0.98
PIT4445001:Asns UTSW 6 7,689,277 (GRCm39) missense probably damaging 1.00
R0034:Asns UTSW 6 7,676,299 (GRCm39) missense probably damaging 1.00
R0034:Asns UTSW 6 7,676,299 (GRCm39) missense probably damaging 1.00
R0050:Asns UTSW 6 7,676,019 (GRCm39) missense probably benign 0.02
R0627:Asns UTSW 6 7,675,516 (GRCm39) missense probably benign 0.05
R1075:Asns UTSW 6 7,676,076 (GRCm39) nonsense probably null
R1591:Asns UTSW 6 7,678,007 (GRCm39) missense probably damaging 0.97
R2047:Asns UTSW 6 7,680,093 (GRCm39) missense probably damaging 0.99
R2232:Asns UTSW 6 7,689,316 (GRCm39) missense possibly damaging 0.82
R2907:Asns UTSW 6 7,675,506 (GRCm39) missense probably benign 0.03
R3907:Asns UTSW 6 7,682,270 (GRCm39) critical splice donor site probably null
R4373:Asns UTSW 6 7,677,978 (GRCm39) missense probably damaging 0.98
R4438:Asns UTSW 6 7,675,320 (GRCm39) missense probably benign 0.15
R4660:Asns UTSW 6 7,678,012 (GRCm39) missense probably benign 0.05
R4784:Asns UTSW 6 7,678,029 (GRCm39) missense probably benign 0.12
R5655:Asns UTSW 6 7,685,309 (GRCm39) missense probably benign 0.31
R5752:Asns UTSW 6 7,689,365 (GRCm39) missense probably damaging 1.00
R5863:Asns UTSW 6 7,675,443 (GRCm39) nonsense probably null
R5864:Asns UTSW 6 7,675,443 (GRCm39) nonsense probably null
R6773:Asns UTSW 6 7,676,284 (GRCm39) missense probably benign 0.01
R6789:Asns UTSW 6 7,675,344 (GRCm39) missense probably benign
R7389:Asns UTSW 6 7,689,291 (GRCm39) missense probably damaging 1.00
R7524:Asns UTSW 6 7,677,259 (GRCm39) splice site probably null
R7783:Asns UTSW 6 7,677,978 (GRCm39) missense probably damaging 1.00
R7949:Asns UTSW 6 7,685,328 (GRCm39) missense probably damaging 0.97
R8722:Asns UTSW 6 7,676,085 (GRCm39) missense probably damaging 1.00
R9405:Asns UTSW 6 7,689,283 (GRCm39) missense probably damaging 0.99
R9663:Asns UTSW 6 7,680,132 (GRCm39) missense probably damaging 1.00
R9697:Asns UTSW 6 7,689,268 (GRCm39) missense probably damaging 1.00
R9798:Asns UTSW 6 7,689,395 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAGATGAGGCAAGCAGTCTAC -3'
(R):5'- AGAAGCACCTAATTGCATACGTTG -3'

Sequencing Primer
(F):5'- GGCAAGCAGTCTACTACATCATTGTG -3'
(R):5'- ACGTTGCTGTTTTCCATTTATAGGC -3'
Posted On 2017-03-31