Mutagenetix > Incidental Mutations

Incidental Mutation 'R5953:Asns'

470998

Institutional Source

Beutler Lab

Gene Symbol

Asns

Ensembl Gene

ENSMUSG00000029752

Gene Name

asparagine synthetase

Synonyms

MMRRC Submission

043245-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.529) question?

Stock #

R5953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7675169-7693254 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7682285 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 220 (E220G)

Ref Sequence

ENSEMBL: ENSMUSP00000115415 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542] [ENSMUST00000126303] [ENSMUST00000139596] [ENSMUST00000148349]

Predicted Effect

probably benign
Transcript: ENSMUST00000031766
AA Change: E220G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: E220G

Domain	Start	End	E-Value	Type
Pfam:GATase_6	29	160	4.3e-21	PFAM
Pfam:GATase_7	47	166	9.1e-26	PFAM
Pfam:DUF3700	68	178	5.5e-6	PFAM
Pfam:GATase_2	91	161	3.3e-5	PFAM
Pfam:Asn_synthase	234	467	1.7e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115542
AA Change: E220G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: E220G

Domain	Start	End	E-Value	Type
Pfam:GATase_6	29	160	1.2e-19	PFAM
Pfam:GATase_7	47	166	4.8e-25	PFAM
Pfam:DUF3700	64	180	3.3e-6	PFAM
Pfam:Asn_synthase	234	390	2.4e-46	PFAM
Pfam:Asn_synthase	382	547	1.5e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126303
AA Change: E220G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000115415
Gene: ENSMUSG00000029752
AA Change: E220G

Domain	Start	End	E-Value	Type
Pfam:GATase_6	28	160	1.3e-24	PFAM
Pfam:GATase_7	47	166	3.1e-29	PFAM
Pfam:DUF3700	67	180	6.3e-10	PFAM
Pfam:GATase_2	89	161	1.4e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133972

Predicted Effect

probably benign
Transcript: ENSMUST00000139596

SMART Domains

Protein: ENSMUSP00000120489
Gene: ENSMUSG00000029752

Domain	Start	End	E-Value	Type
Pfam:GATase_6	26	157	7e-25	PFAM
Pfam:GATase_7	47	157	1e-27	PFAM
Pfam:DUF3700	66	158	5.7e-9	PFAM
Pfam:GATase_2	89	158	1.8e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140097

Predicted Effect

probably benign
Transcript: ENSMUST00000148349

SMART Domains

Protein: ENSMUSP00000118003
Gene: ENSMUSG00000029752

Domain	Start	End	E-Value	Type
Pfam:GATase_6	24	127	1.4e-17	PFAM
Pfam:GATase_7	47	127	2.6e-18	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,361,018	S675T	probably damaging	Het
Acvr2a	T	C	2: 48,890,404	L212P	probably damaging	Het
Adamts14	T	C	10: 61,207,446	T751A	probably damaging	Het
Adgrf2	T	C	17: 42,710,338	N532D	probably damaging	Het
Cd209d	A	T	8: 3,877,979		probably null	Het
Cenpp	T	C	13: 49,652,685	D2G	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Clec4a3	G	T	6: 122,969,492	V232L	probably benign	Het
Cntln	C	T	4: 85,049,919	H792Y	possibly damaging	Het
Cobl	T	A	11: 12,256,220	T470S	probably benign	Het
Cym	T	A	3: 107,213,467	D274V	probably damaging	Het
Elac2	G	A	11: 64,999,223	C627Y	probably benign	Het
Emc7	T	A	2: 112,459,558	I111N	probably damaging	Het
Eya4	T	A	10: 23,151,973	Y310F	probably damaging	Het
Fam217b	C	T	2: 178,420,360	S39F	probably damaging	Het
Fam234b	G	T	6: 135,225,707	R353L	possibly damaging	Het
Focad	A	G	4: 88,229,335	I404V	probably benign	Het
Il1rl1	T	A	1: 40,442,673	D180E	probably benign	Het
Il2rb	A	T	15: 78,484,982	C256*	probably null	Het
Intu	A	C	3: 40,679,550	L404F	probably damaging	Het
Jmy	G	A	13: 93,499,116	T64M	possibly damaging	Het
Mpl	C	A	4: 118,454,510	S302I	possibly damaging	Het
Mpl	T	A	4: 118,454,511	S302C	probably damaging	Het
Muc2	G	T	7: 141,701,382	D241Y	probably damaging	Het
Nlrp3	C	T	11: 59,546,791	H99Y	probably benign	Het
Olfr1474	A	T	19: 13,471,368	I133F	possibly damaging	Het
Olfr812	C	G	10: 129,842,614	V143L	probably benign	Het
Pglyrp1	A	T	7: 18,890,313	I174F	probably damaging	Het
Pi4ka	A	T	16: 17,281,951	I1936N	probably damaging	Het
Plekhm3	C	T	1: 64,937,895	E139K	probably damaging	Het
Pomk	C	A	8: 25,983,048	L292F	probably damaging	Het
Ptpru	A	G	4: 131,776,837	I1103T	probably damaging	Het
Pygl	T	C	12: 70,219,627	D38G	probably damaging	Het
Rapsn	T	C	2: 91,041,963	V214A	probably benign	Het
S100a9	T	A	3: 90,692,927	K54M	probably damaging	Het
Sdk2	A	G	11: 113,793,744	Y1964H	probably damaging	Het
Slc17a5	T	C	9: 78,557,498	N331S	probably damaging	Het
Snx9	T	A	17: 5,908,402	C252S	probably damaging	Het
Snx9	G	T	17: 5,908,403	C252F	probably damaging	Het
Trem1	A	T	17: 48,237,192	M82L	probably benign	Het

Other mutations in Asns

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Asns	APN	6	7680179	missense	probably damaging	1.00
IGL00656:Asns	APN	6	7680215	unclassified	probably benign
IGL01534:Asns	APN	6	7675397	missense	probably benign	0.03
IGL01996:Asns	APN	6	7682378	missense	possibly damaging	0.56
IGL02058:Asns	APN	6	7685184	missense	probably damaging	1.00
IGL02311:Asns	APN	6	7676233	critical splice donor site	probably null
IGL02367:Asns	APN	6	7685411	splice site	probably benign
IGL03263:Asns	APN	6	7689404	missense	probably benign	0.07
IGL03341:Asns	APN	6	7682002	missense	probably damaging	0.98
PIT4445001:Asns	UTSW	6	7689277	missense	probably damaging	1.00
R0034:Asns	UTSW	6	7676299	missense	probably damaging	1.00
R0034:Asns	UTSW	6	7676299	missense	probably damaging	1.00
R0050:Asns	UTSW	6	7676019	missense	probably benign	0.02
R0627:Asns	UTSW	6	7675516	missense	probably benign	0.05
R1075:Asns	UTSW	6	7676076	nonsense	probably null
R1591:Asns	UTSW	6	7678007	missense	probably damaging	0.97
R2047:Asns	UTSW	6	7680093	missense	probably damaging	0.99
R2232:Asns	UTSW	6	7689316	missense	possibly damaging	0.82
R2907:Asns	UTSW	6	7675506	missense	probably benign	0.03
R3907:Asns	UTSW	6	7682270	critical splice donor site	probably null
R4373:Asns	UTSW	6	7677978	missense	probably damaging	0.98
R4438:Asns	UTSW	6	7675320	missense	probably benign	0.15
R4660:Asns	UTSW	6	7678012	missense	probably benign	0.05
R4784:Asns	UTSW	6	7678029	missense	probably benign	0.12
R5655:Asns	UTSW	6	7685309	missense	probably benign	0.31
R5752:Asns	UTSW	6	7689365	missense	probably damaging	1.00
R5863:Asns	UTSW	6	7675443	nonsense	probably null
R5864:Asns	UTSW	6	7675443	nonsense	probably null
R6773:Asns	UTSW	6	7676284	missense	probably benign	0.01
R6789:Asns	UTSW	6	7675344	missense	probably benign
R7389:Asns	UTSW	6	7689291	missense	probably damaging	1.00
R7524:Asns	UTSW	6	7677259	synonymous	probably null
R7783:Asns	UTSW	6	7677978	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGATGAGGCAAGCAGTCTAC -3'
(R):5'- AGAAGCACCTAATTGCATACGTTG -3'

Sequencing Primer
(F):5'- GGCAAGCAGTCTACTACATCATTGTG -3'
(R):5'- ACGTTGCTGTTTTCCATTTATAGGC -3'

Posted On

2017-03-31