Incidental Mutation 'R5953:Asns'
ID 470998
Institutional Source Beutler Lab
Gene Symbol Asns
Ensembl Gene ENSMUSG00000029752
Gene Name asparagine synthetase
Synonyms
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 7675169-7693254 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7682285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 220 (E220G)
Ref Sequence ENSEMBL: ENSMUSP00000115415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542] [ENSMUST00000126303] [ENSMUST00000139596] [ENSMUST00000148349]
AlphaFold Q61024
Predicted Effect probably benign
Transcript: ENSMUST00000031766
AA Change: E220G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: E220G

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 4.3e-21 PFAM
Pfam:GATase_7 47 166 9.1e-26 PFAM
Pfam:DUF3700 68 178 5.5e-6 PFAM
Pfam:GATase_2 91 161 3.3e-5 PFAM
Pfam:Asn_synthase 234 467 1.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115542
AA Change: E220G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: E220G

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 1.2e-19 PFAM
Pfam:GATase_7 47 166 4.8e-25 PFAM
Pfam:DUF3700 64 180 3.3e-6 PFAM
Pfam:Asn_synthase 234 390 2.4e-46 PFAM
Pfam:Asn_synthase 382 547 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126303
AA Change: E220G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115415
Gene: ENSMUSG00000029752
AA Change: E220G

DomainStartEndE-ValueType
Pfam:GATase_6 28 160 1.3e-24 PFAM
Pfam:GATase_7 47 166 3.1e-29 PFAM
Pfam:DUF3700 67 180 6.3e-10 PFAM
Pfam:GATase_2 89 161 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133972
Predicted Effect probably benign
Transcript: ENSMUST00000139596
SMART Domains Protein: ENSMUSP00000120489
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 26 157 7e-25 PFAM
Pfam:GATase_7 47 157 1e-27 PFAM
Pfam:DUF3700 66 158 5.7e-9 PFAM
Pfam:GATase_2 89 158 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140097
Predicted Effect probably benign
Transcript: ENSMUST00000148349
SMART Domains Protein: ENSMUSP00000118003
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 24 127 1.4e-17 PFAM
Pfam:GATase_7 47 127 2.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Asns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Asns APN 6 7680179 missense probably damaging 1.00
IGL00656:Asns APN 6 7680215 unclassified probably benign
IGL01534:Asns APN 6 7675397 missense probably benign 0.03
IGL01996:Asns APN 6 7682378 missense possibly damaging 0.56
IGL02058:Asns APN 6 7685184 missense probably damaging 1.00
IGL02311:Asns APN 6 7676233 critical splice donor site probably null
IGL02367:Asns APN 6 7685411 splice site probably benign
IGL03263:Asns APN 6 7689404 missense probably benign 0.07
IGL03341:Asns APN 6 7682002 missense probably damaging 0.98
PIT4445001:Asns UTSW 6 7689277 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0050:Asns UTSW 6 7676019 missense probably benign 0.02
R0627:Asns UTSW 6 7675516 missense probably benign 0.05
R1075:Asns UTSW 6 7676076 nonsense probably null
R1591:Asns UTSW 6 7678007 missense probably damaging 0.97
R2047:Asns UTSW 6 7680093 missense probably damaging 0.99
R2232:Asns UTSW 6 7689316 missense possibly damaging 0.82
R2907:Asns UTSW 6 7675506 missense probably benign 0.03
R3907:Asns UTSW 6 7682270 critical splice donor site probably null
R4373:Asns UTSW 6 7677978 missense probably damaging 0.98
R4438:Asns UTSW 6 7675320 missense probably benign 0.15
R4660:Asns UTSW 6 7678012 missense probably benign 0.05
R4784:Asns UTSW 6 7678029 missense probably benign 0.12
R5655:Asns UTSW 6 7685309 missense probably benign 0.31
R5752:Asns UTSW 6 7689365 missense probably damaging 1.00
R5863:Asns UTSW 6 7675443 nonsense probably null
R5864:Asns UTSW 6 7675443 nonsense probably null
R6773:Asns UTSW 6 7676284 missense probably benign 0.01
R6789:Asns UTSW 6 7675344 missense probably benign
R7389:Asns UTSW 6 7689291 missense probably damaging 1.00
R7524:Asns UTSW 6 7677259 splice site probably null
R7783:Asns UTSW 6 7677978 missense probably damaging 1.00
R7949:Asns UTSW 6 7685328 missense probably damaging 0.97
R8722:Asns UTSW 6 7676085 missense probably damaging 1.00
R9405:Asns UTSW 6 7689283 missense probably damaging 0.99
R9663:Asns UTSW 6 7680132 missense probably damaging 1.00
R9697:Asns UTSW 6 7689268 missense probably damaging 1.00
R9798:Asns UTSW 6 7689395 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAGATGAGGCAAGCAGTCTAC -3'
(R):5'- AGAAGCACCTAATTGCATACGTTG -3'

Sequencing Primer
(F):5'- GGCAAGCAGTCTACTACATCATTGTG -3'
(R):5'- ACGTTGCTGTTTTCCATTTATAGGC -3'
Posted On 2017-03-31