Incidental Mutation 'R5953:Clec4a3'
List |< first << previous [record 9 of 41] next >> last >|
ID471001
Institutional Source Beutler Lab
Gene Symbol Clec4a3
Ensembl Gene ENSMUSG00000043832
Gene NameC-type lectin domain family 4, member a3
Synonyms3110037K17Rik, mDcir3
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122952515-122969875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122969492 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 232 (V232L)
Ref Sequence ENSEMBL: ENSMUSP00000112716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088468] [ENSMUST00000117173] [ENSMUST00000204427]
Predicted Effect probably benign
Transcript: ENSMUST00000088468
AA Change: V232L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000085816
Gene: ENSMUSG00000043832
AA Change: V232L

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 231 1.97e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117173
AA Change: V232L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112716
Gene: ENSMUSG00000043832
AA Change: V232L

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
CLECT 107 231 1.97e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204427
SMART Domains Protein: ENSMUSP00000144856
Gene: ENSMUSG00000043832

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
SCOP:d1e87a_ 71 109 1e-8 SMART
Blast:CLECT 73 109 2e-20 BLAST
PDB:3VYK|A 73 109 7e-13 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Clec4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Clec4a3 APN 6 122952860 utr 5 prime probably benign
IGL02210:Clec4a3 APN 6 122954108 missense probably damaging 0.98
IGL02874:Clec4a3 APN 6 122967560 missense probably benign 0.16
IGL02983:Clec4a3 APN 6 122967567 critical splice donor site probably null
R0035:Clec4a3 UTSW 6 122967549 missense probably damaging 1.00
R0035:Clec4a3 UTSW 6 122967549 missense probably damaging 1.00
R0334:Clec4a3 UTSW 6 122969370 missense possibly damaging 0.81
R0671:Clec4a3 UTSW 6 122954034 critical splice acceptor site probably null
R1508:Clec4a3 UTSW 6 122967508 missense probably benign 0.05
R1739:Clec4a3 UTSW 6 122954041 nonsense probably null
R3547:Clec4a3 UTSW 6 122964280 missense probably damaging 1.00
R5836:Clec4a3 UTSW 6 122952902 missense possibly damaging 0.66
R7178:Clec4a3 UTSW 6 122964292 missense probably benign 0.02
R7664:Clec4a3 UTSW 6 122966422 missense probably benign 0.03
R7763:Clec4a3 UTSW 6 122964340 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTGAGTGCTGTGATCTC -3'
(R):5'- CAAGTAAGTTTACACATGTGCCAG -3'

Sequencing Primer
(F):5'- GAGTGCTGTGATCTCCATAAATTCC -3'
(R):5'- AGTTTACACATGTGCCAGTATTATC -3'
Posted On2017-03-31