Incidental Mutation 'R5953:Pglyrp1'
ID471003
Institutional Source Beutler Lab
Gene Symbol Pglyrp1
Ensembl Gene ENSMUSG00000030413
Gene Namepeptidoglycan recognition protein 1
SynonymsPGRP-S, Tnfsf3l, peptidoglycan recognition protein, Tag7, Tasg7
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18871331-18890459 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18890313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 174 (I174F)
Ref Sequence ENSEMBL: ENSMUSP00000032573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032573] [ENSMUST00000098780] [ENSMUST00000133506] [ENSMUST00000135467]
Predicted Effect probably damaging
Transcript: ENSMUST00000032573
AA Change: I174F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032573
Gene: ENSMUSG00000030413
AA Change: I174F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PGRP 18 161 8.93e-75 SMART
Ami_2 29 167 5.11e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098780
SMART Domains Protein: ENSMUSP00000096377
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
coiled coil region 173 206 N/A INTRINSIC
low complexity region 217 242 N/A INTRINSIC
coiled coil region 243 280 N/A INTRINSIC
low complexity region 290 332 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 400 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133506
SMART Domains Protein: ENSMUSP00000123152
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
low complexity region 28 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206481
Predicted Effect probably benign
Transcript: ENSMUST00000206499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206595
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a defect in neutrophil killing and increased susceptibility to infection with non-pathogenic gram-positive bacteria or DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Pglyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0049:Pglyrp1 UTSW 7 18889388 missense probably damaging 1.00
R0049:Pglyrp1 UTSW 7 18889388 missense probably damaging 1.00
R0747:Pglyrp1 UTSW 7 18890275 missense possibly damaging 0.52
R1687:Pglyrp1 UTSW 7 18884704 start gained probably benign
R1900:Pglyrp1 UTSW 7 18890226 missense probably damaging 1.00
R4696:Pglyrp1 UTSW 7 18884946 missense probably benign 0.42
R4903:Pglyrp1 UTSW 7 18890203 missense probably benign 0.01
R8178:Pglyrp1 UTSW 7 18884732 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGTGTGGACAGACCCAGC -3'
(R):5'- TTCCTGCACCAGTGAGGATG -3'

Sequencing Primer
(F):5'- CTGACATAGAGGGCAGTTTACC -3'
(R):5'- TGGCCCGAGATATGTGCAG -3'
Posted On2017-03-31