Incidental Mutation 'R5953:Pglyrp1'
ID 471003
Institutional Source Beutler Lab
Gene Symbol Pglyrp1
Ensembl Gene ENSMUSG00000030413
Gene Name peptidoglycan recognition protein 1
Synonyms peptidoglycan recognition protein, Tag7, Tasg7, PGRP-S, Tnfsf3l
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 18618615-18624363 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18624238 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 174 (I174F)
Ref Sequence ENSEMBL: ENSMUSP00000032573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032573] [ENSMUST00000098780] [ENSMUST00000133506] [ENSMUST00000135467]
AlphaFold O88593
Predicted Effect probably damaging
Transcript: ENSMUST00000032573
AA Change: I174F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032573
Gene: ENSMUSG00000030413
AA Change: I174F

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PGRP 18 161 8.93e-75 SMART
Ami_2 29 167 5.11e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098780
SMART Domains Protein: ENSMUSP00000096377
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
coiled coil region 173 206 N/A INTRINSIC
low complexity region 217 242 N/A INTRINSIC
coiled coil region 243 280 N/A INTRINSIC
low complexity region 290 332 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 400 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133506
SMART Domains Protein: ENSMUSP00000123152
Gene: ENSMUSG00000074358

DomainStartEndE-ValueType
low complexity region 28 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206481
Predicted Effect probably benign
Transcript: ENSMUST00000206499
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a defect in neutrophil killing and increased susceptibility to infection with non-pathogenic gram-positive bacteria or DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Pglyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0049:Pglyrp1 UTSW 7 18,623,313 (GRCm39) missense probably damaging 1.00
R0049:Pglyrp1 UTSW 7 18,623,313 (GRCm39) missense probably damaging 1.00
R0747:Pglyrp1 UTSW 7 18,624,200 (GRCm39) missense possibly damaging 0.52
R1687:Pglyrp1 UTSW 7 18,618,629 (GRCm39) start gained probably benign
R1900:Pglyrp1 UTSW 7 18,624,151 (GRCm39) missense probably damaging 1.00
R4696:Pglyrp1 UTSW 7 18,618,871 (GRCm39) missense probably benign 0.42
R4903:Pglyrp1 UTSW 7 18,624,128 (GRCm39) missense probably benign 0.01
R8178:Pglyrp1 UTSW 7 18,618,657 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGTGTGGACAGACCCAGC -3'
(R):5'- TTCCTGCACCAGTGAGGATG -3'

Sequencing Primer
(F):5'- CTGACATAGAGGGCAGTTTACC -3'
(R):5'- TGGCCCGAGATATGTGCAG -3'
Posted On 2017-03-31