Incidental Mutation 'R5953:Cd209d'
ID471006
Institutional Source Beutler Lab
Gene Symbol Cd209d
Ensembl Gene ENSMUSG00000031495
Gene NameCD209d antigen
SynonymsSIGN-R3, mSIGNR3, SIGNR3
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3871824-3878555 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 3877979 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011445] [ENSMUST00000011445] [ENSMUST00000209176]
Predicted Effect probably null
Transcript: ENSMUST00000011445
SMART Domains Protein: ENSMUSP00000011445
Gene: ENSMUSG00000031495

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
CLECT 106 227 2.34e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000011445
SMART Domains Protein: ENSMUSP00000011445
Gene: ENSMUSG00000031495

DomainStartEndE-ValueType
low complexity region 54 74 N/A INTRINSIC
CLECT 106 227 2.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209176
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to bacterial infection despite decreased T and B cell proliferation and extramedullary hematopoiesis in the spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Cd209d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Cd209d APN 8 3877974 splice site probably null
IGL01707:Cd209d APN 8 3878296 missense probably benign
IGL02864:Cd209d APN 8 3877122 missense probably benign 0.08
IGL03066:Cd209d APN 8 3878437 critical splice donor site probably null
IGL03297:Cd209d APN 8 3878476 missense possibly damaging 0.92
R0324:Cd209d UTSW 8 3878258 missense probably benign 0.31
R1335:Cd209d UTSW 8 3872027 missense probably damaging 1.00
R1349:Cd209d UTSW 8 3878515 unclassified probably benign
R1372:Cd209d UTSW 8 3878515 unclassified probably benign
R1507:Cd209d UTSW 8 3878453 missense possibly damaging 0.72
R1673:Cd209d UTSW 8 3877113 missense probably damaging 1.00
R2393:Cd209d UTSW 8 3878436 critical splice donor site probably null
R2567:Cd209d UTSW 8 3876327 missense probably damaging 1.00
R4907:Cd209d UTSW 8 3877948 missense probably benign 0.01
R5349:Cd209d UTSW 8 3878320 missense probably benign 0.00
R5768:Cd209d UTSW 8 3871968 missense probably benign 0.05
R5949:Cd209d UTSW 8 3877949 missense possibly damaging 0.50
R6103:Cd209d UTSW 8 3878304 missense probably damaging 1.00
R7382:Cd209d UTSW 8 3877965 nonsense probably null
X0025:Cd209d UTSW 8 3877961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGAGGTTATGTTCTCAACTTGC -3'
(R):5'- TGGGTCCTGGGAAATTGAAG -3'

Sequencing Primer
(F):5'- GAGGTTATGTTCTCAACTTGCATTTC -3'
(R):5'- AACTTCTCATTCAGTCCTGGGAGATG -3'
Posted On2017-03-31