Incidental Mutation 'R5953:Slc17a5'
ID 471009
Institutional Source Beutler Lab
Gene Symbol Slc17a5
Ensembl Gene ENSMUSG00000049624
Gene Name solute carrier family 17 (anion/sugar transporter), member 5
Synonyms 4631416G20Rik
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 78536488-78588041 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78557498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 331 (N331S)
Ref Sequence ENSEMBL: ENSMUSP00000113003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052441] [ENSMUST00000117645]
AlphaFold Q8BN82
Predicted Effect probably benign
Transcript: ENSMUST00000052441
AA Change: N357S

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056182
Gene: ENSMUSG00000049624
AA Change: N357S

DomainStartEndE-ValueType
Pfam:MFS_1 46 441 1.8e-61 PFAM
transmembrane domain 456 478 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117645
AA Change: N331S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113003
Gene: ENSMUSG00000049624
AA Change: N331S

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
Pfam:MFS_1 97 415 2.5e-50 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane transporter that exports free sialic acids that have been cleaved off of cell surface lipids and proteins from lysosomes. Mutations in this gene cause sialic acid storage diseases, including infantile sialic acid storage disorder and and Salla disease, an adult form. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit numerous neurological abnormalities, including impaired exploratory and locomotor activity, hearing deficits, and an increased depressive-like response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Slc17a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc17a5 APN 9 78578534 missense probably benign
IGL00828:Slc17a5 APN 9 78578551 missense probably benign 0.37
IGL01603:Slc17a5 APN 9 78574707 missense probably damaging 1.00
IGL01945:Slc17a5 APN 9 78587932 missense probably benign 0.01
IGL03250:Slc17a5 APN 9 78578564 missense probably damaging 0.99
PIT4618001:Slc17a5 UTSW 9 78538248 missense possibly damaging 0.52
R0136:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0245:Slc17a5 UTSW 9 78540924 missense probably benign 0.00
R0305:Slc17a5 UTSW 9 78557537 missense probably benign 0.25
R0481:Slc17a5 UTSW 9 78538302 splice site probably null
R0657:Slc17a5 UTSW 9 78578674 missense probably damaging 1.00
R0763:Slc17a5 UTSW 9 78553090 splice site probably benign
R1543:Slc17a5 UTSW 9 78560800 missense probably benign 0.01
R1564:Slc17a5 UTSW 9 78578699 missense probably damaging 0.98
R2155:Slc17a5 UTSW 9 78577173 missense probably damaging 1.00
R2483:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R3623:Slc17a5 UTSW 9 78538274 missense probably damaging 1.00
R4193:Slc17a5 UTSW 9 78559106 missense possibly damaging 0.58
R4794:Slc17a5 UTSW 9 78574715 missense probably damaging 0.96
R5115:Slc17a5 UTSW 9 78577112 missense probably benign 0.12
R5141:Slc17a5 UTSW 9 78540988 missense probably damaging 1.00
R5205:Slc17a5 UTSW 9 78578617 missense probably damaging 1.00
R6481:Slc17a5 UTSW 9 78538271 missense possibly damaging 0.87
R7375:Slc17a5 UTSW 9 78587892 missense probably benign 0.00
R8309:Slc17a5 UTSW 9 78571029 nonsense probably null
R8720:Slc17a5 UTSW 9 78578663 missense probably damaging 0.98
R9286:Slc17a5 UTSW 9 78538284 missense probably damaging 1.00
R9425:Slc17a5 UTSW 9 78577175 missense probably damaging 1.00
R9567:Slc17a5 UTSW 9 78538280 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTGTGTGCTGCAAAGCTG -3'
(R):5'- GTGCCATGATTGCAGCTGATG -3'

Sequencing Primer
(F):5'- CAAAGCTGATTGTGTGTGGGAAAATC -3'
(R):5'- ATGTGGACATCGCCACATTG -3'
Posted On 2017-03-31