Mutagenetix > Incidental Mutation

Incidental Mutation 'R5953:Eya4'

471010

Institutional Source

Beutler Lab

Gene Symbol

Eya4

Ensembl Gene

ENSMUSG00000010461

Gene Name

EYA transcriptional coactivator and phosphatase 4

Synonyms

B130023L16Rik

MMRRC Submission

043245-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23102963-23350786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23151973 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 310 (Y310F)

Ref Sequence

ENSEMBL: ENSMUSP00000151483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]

AlphaFold

Q9Z191

Predicted Effect

probably damaging
Transcript: ENSMUST00000074366
AA Change: Y287F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: Y287F

Domain	Start	End	E-Value	Type
low complexity region	49	72	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC
low complexity region	322	334	N/A	INTRINSIC
PDB:4EGC\|B	336	616	1e-163	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000092665
AA Change: Y287F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: Y287F

Domain	Start	End	E-Value	Type
low complexity region	49	72	N/A	INTRINSIC
low complexity region	231	243	N/A	INTRINSIC
low complexity region	322	334	N/A	INTRINSIC
PDB:4EGC\|B	336	616	1e-172	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000219315
AA Change: Y310F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000220299
AA Change: Y287F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,361,018	S675T	probably damaging	Het
Acvr2a	T	C	2: 48,890,404	L212P	probably damaging	Het
Adamts14	T	C	10: 61,207,446	T751A	probably damaging	Het
Adgrf2	T	C	17: 42,710,338	N532D	probably damaging	Het
Asns	T	C	6: 7,682,285	E220G	probably benign	Het
Cd209d	A	T	8: 3,877,979		probably null	Het
Cenpp	T	C	13: 49,652,685	D2G	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Clec4a3	G	T	6: 122,969,492	V232L	probably benign	Het
Cntln	C	T	4: 85,049,919	H792Y	possibly damaging	Het
Cobl	T	A	11: 12,256,220	T470S	probably benign	Het
Cym	T	A	3: 107,213,467	D274V	probably damaging	Het
Elac2	G	A	11: 64,999,223	C627Y	probably benign	Het
Emc7	T	A	2: 112,459,558	I111N	probably damaging	Het
Fam217b	C	T	2: 178,420,360	S39F	probably damaging	Het
Fam234b	G	T	6: 135,225,707	R353L	possibly damaging	Het
Focad	A	G	4: 88,229,335	I404V	probably benign	Het
Il1rl1	T	A	1: 40,442,673	D180E	probably benign	Het
Il2rb	A	T	15: 78,484,982	C256*	probably null	Het
Intu	A	C	3: 40,679,550	L404F	probably damaging	Het
Jmy	G	A	13: 93,499,116	T64M	possibly damaging	Het
Mpl	C	A	4: 118,454,510	S302I	possibly damaging	Het
Mpl	T	A	4: 118,454,511	S302C	probably damaging	Het
Muc2	G	T	7: 141,701,382	D241Y	probably damaging	Het
Nlrp3	C	T	11: 59,546,791	H99Y	probably benign	Het
Olfr1474	A	T	19: 13,471,368	I133F	possibly damaging	Het
Olfr812	C	G	10: 129,842,614	V143L	probably benign	Het
Pglyrp1	A	T	7: 18,890,313	I174F	probably damaging	Het
Pi4ka	A	T	16: 17,281,951	I1936N		Het
Plekhm3	C	T	1: 64,937,895	E139K	probably damaging	Het
Pomk	C	A	8: 25,983,048	L292F	probably damaging	Het
Ptpru	A	G	4: 131,776,837	I1103T	probably damaging	Het
Pygl	T	C	12: 70,219,627	D38G	probably damaging	Het
Rapsn	T	C	2: 91,041,963	V214A	probably benign	Het
S100a9	T	A	3: 90,692,927	K54M	probably damaging	Het
Sdk2	A	G	11: 113,793,744	Y1964H	probably damaging	Het
Slc17a5	T	C	9: 78,557,498	N331S	probably damaging	Het
Snx9	T	A	17: 5,908,402	C252S	probably damaging	Het
Snx9	G	T	17: 5,908,403	C252F	probably damaging	Het
Trem1	A	T	17: 48,237,192	M82L	probably benign	Het

Other mutations in Eya4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Eya4	APN	10	23159097	missense	probably benign	0.17
IGL00507:Eya4	APN	10	23157536	nonsense	probably null
IGL01324:Eya4	APN	10	23116551	critical splice donor site	probably null
IGL01350:Eya4	APN	10	23113974	missense	possibly damaging	0.88
IGL01397:Eya4	APN	10	23139999	missense	probably benign	0.01
IGL02682:Eya4	APN	10	23116600	missense	probably damaging	1.00
IGL02688:Eya4	APN	10	23159110	missense	probably benign	0.01
IGL03071:Eya4	APN	10	23323073	missense	probably benign	0.07
R0420:Eya4	UTSW	10	23155963	missense	possibly damaging	0.85
R1688:Eya4	UTSW	10	23123861	missense	probably damaging	1.00
R2312:Eya4	UTSW	10	23106264	missense	probably damaging	1.00
R3029:Eya4	UTSW	10	23123878	missense	probably benign
R3853:Eya4	UTSW	10	23116676	missense	probably damaging	1.00
R3872:Eya4	UTSW	10	23155972	missense	probably damaging	0.97
R4113:Eya4	UTSW	10	23155951	missense	probably damaging	0.98
R4210:Eya4	UTSW	10	23226800	critical splice donor site	probably null
R4457:Eya4	UTSW	10	23116668	missense	probably damaging	1.00
R4691:Eya4	UTSW	10	23140068	missense	probably benign	0.03
R4894:Eya4	UTSW	10	23109854	missense	possibly damaging	0.55
R5345:Eya4	UTSW	10	23110048	missense	probably benign	0.00
R5473:Eya4	UTSW	10	23163453	missense	probably benign	0.02
R5547:Eya4	UTSW	10	23109854	missense	possibly damaging	0.55
R5698:Eya4	UTSW	10	23140077	missense	possibly damaging	0.50
R5951:Eya4	UTSW	10	23155994	missense	probably damaging	1.00
R6111:Eya4	UTSW	10	23140055	missense	possibly damaging	0.67
R6413:Eya4	UTSW	10	23116826	missense	probably damaging	1.00
R6460:Eya4	UTSW	10	23152012	missense	probably benign	0.05
R7144:Eya4	UTSW	10	23173045	missense	probably benign	0.00
R7169:Eya4	UTSW	10	23155947	missense	probably benign	0.42
R7358:Eya4	UTSW	10	23123851	critical splice donor site	probably null
R7549:Eya4	UTSW	10	23111658	missense	probably damaging	1.00
R7791:Eya4	UTSW	10	23113926	missense	probably damaging	1.00
R7793:Eya4	UTSW	10	23226816	missense	probably benign
R8550:Eya4	UTSW	10	23106258	missense	probably damaging	1.00
R8553:Eya4	UTSW	10	23106258	missense	probably damaging	1.00
R8556:Eya4	UTSW	10	23106258	missense	probably damaging	1.00
R8703:Eya4	UTSW	10	23163442	missense	probably benign	0.00
R9332:Eya4	UTSW	10	23113946	missense	probably damaging	0.97
R9361:Eya4	UTSW	10	23109867	missense	probably damaging	1.00
R9408:Eya4	UTSW	10	23123907	missense
R9497:Eya4	UTSW	10	23111559	critical splice donor site	probably null
R9713:Eya4	UTSW	10	23151972	nonsense	probably null
Z1088:Eya4	UTSW	10	23113988	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTTATGCAGCCAGCTAAAAC -3'
(R):5'- TGGTGATGATGCTACCTTGC -3'

Sequencing Primer
(F):5'- TGCAGCCAGCTAAAACTCATTAATC -3'
(R):5'- GATGATGCTACCTTGCTCCTTTAGAC -3'

Posted On

2017-03-31