Incidental Mutation 'R5953:Adamts14'
ID 471011
Institutional Source Beutler Lab
Gene Symbol Adamts14
Ensembl Gene ENSMUSG00000059901
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms TS14, Adamts-14
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 61032891-61109217 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61043225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 751 (T751A)
Ref Sequence ENSEMBL: ENSMUSP00000112723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]
AlphaFold E9PX39
Predicted Effect probably damaging
Transcript: ENSMUST00000092486
AA Change: T748A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: T748A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 194 6.3e-30 PFAM
Pfam:Reprolysin_5 245 424 6e-17 PFAM
Pfam:Reprolysin_4 246 432 2.5e-7 PFAM
Pfam:Reprolysin 246 447 1.9e-21 PFAM
Pfam:Reprolysin_2 264 437 9.2e-10 PFAM
Pfam:Reprolysin_3 268 396 2.5e-12 PFAM
TSP1 542 594 5.9e-16 SMART
Pfam:ADAM_spacer1 701 816 1.8e-24 PFAM
TSP1 837 894 2.1e-2 SMART
TSP1 897 956 3.42e-3 SMART
TSP1 959 1009 4.48e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120336
AA Change: T751A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: T751A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 194 1.6e-38 PFAM
Pfam:Reprolysin_5 245 427 5.9e-16 PFAM
Pfam:Reprolysin_4 246 435 1.1e-7 PFAM
Pfam:Reprolysin 246 450 3.2e-20 PFAM
Pfam:Reprolysin_2 264 441 5.5e-12 PFAM
Pfam:Reprolysin_3 268 399 1.5e-13 PFAM
TSP1 545 597 5.9e-16 SMART
Pfam:ADAM_spacer1 704 819 8e-25 PFAM
TSP1 840 897 2.1e-2 SMART
TSP1 900 959 3.42e-3 SMART
TSP1 962 1012 4.48e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Adamts14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Adamts14 APN 10 61,065,455 (GRCm39) missense probably damaging 1.00
IGL00800:Adamts14 APN 10 61,041,197 (GRCm39) missense probably benign 0.00
IGL01021:Adamts14 APN 10 61,061,152 (GRCm39) missense probably damaging 0.99
IGL01022:Adamts14 APN 10 61,038,721 (GRCm39) missense probably benign 0.01
IGL01335:Adamts14 APN 10 61,034,460 (GRCm39) missense possibly damaging 0.90
IGL01419:Adamts14 APN 10 61,041,321 (GRCm39) splice site probably benign
IGL01595:Adamts14 APN 10 61,041,252 (GRCm39) missense probably damaging 1.00
R0594:Adamts14 UTSW 10 61,038,666 (GRCm39) missense probably damaging 1.00
R0629:Adamts14 UTSW 10 61,047,403 (GRCm39) nonsense probably null
R1459:Adamts14 UTSW 10 61,034,583 (GRCm39) missense probably benign 0.13
R1565:Adamts14 UTSW 10 61,106,676 (GRCm39) missense probably damaging 1.00
R1686:Adamts14 UTSW 10 61,034,439 (GRCm39) missense probably benign
R1792:Adamts14 UTSW 10 61,054,277 (GRCm39) missense probably benign 0.07
R1876:Adamts14 UTSW 10 61,036,151 (GRCm39) missense probably benign 0.03
R1992:Adamts14 UTSW 10 61,034,439 (GRCm39) missense probably benign
R2064:Adamts14 UTSW 10 61,041,301 (GRCm39) missense probably benign 0.24
R2495:Adamts14 UTSW 10 61,034,749 (GRCm39) splice site probably null
R2848:Adamts14 UTSW 10 61,054,214 (GRCm39) missense probably damaging 1.00
R2897:Adamts14 UTSW 10 61,040,689 (GRCm39) missense probably damaging 0.99
R3428:Adamts14 UTSW 10 61,060,153 (GRCm39) missense probably benign 0.36
R4006:Adamts14 UTSW 10 61,038,600 (GRCm39) critical splice donor site probably null
R5129:Adamts14 UTSW 10 61,085,397 (GRCm39) missense probably benign 0.02
R5327:Adamts14 UTSW 10 61,034,267 (GRCm39) missense probably benign 0.01
R5524:Adamts14 UTSW 10 61,066,222 (GRCm39) missense probably damaging 1.00
R5594:Adamts14 UTSW 10 61,062,880 (GRCm39) splice site probably null
R5694:Adamts14 UTSW 10 61,065,431 (GRCm39) missense probably benign 0.45
R5801:Adamts14 UTSW 10 61,038,775 (GRCm39) missense probably damaging 0.99
R5941:Adamts14 UTSW 10 61,057,674 (GRCm39) missense probably damaging 1.00
R6778:Adamts14 UTSW 10 61,061,231 (GRCm39) missense probably damaging 1.00
R7169:Adamts14 UTSW 10 61,040,707 (GRCm39) missense probably damaging 0.97
R7215:Adamts14 UTSW 10 61,047,375 (GRCm39) missense possibly damaging 0.89
R7337:Adamts14 UTSW 10 61,043,239 (GRCm39) missense probably damaging 0.98
R7511:Adamts14 UTSW 10 61,054,307 (GRCm39) missense possibly damaging 0.74
R7640:Adamts14 UTSW 10 61,081,836 (GRCm39) missense probably benign 0.00
R7798:Adamts14 UTSW 10 61,106,952 (GRCm39) missense probably damaging 0.99
R7902:Adamts14 UTSW 10 61,041,176 (GRCm39) missense possibly damaging 0.92
R8062:Adamts14 UTSW 10 61,036,140 (GRCm39) critical splice donor site probably null
R8284:Adamts14 UTSW 10 61,034,438 (GRCm39) missense possibly damaging 0.55
R8319:Adamts14 UTSW 10 61,057,706 (GRCm39) missense probably benign
R8475:Adamts14 UTSW 10 61,038,666 (GRCm39) missense probably damaging 1.00
R8494:Adamts14 UTSW 10 61,038,708 (GRCm39) missense probably benign 0.03
R8519:Adamts14 UTSW 10 61,038,619 (GRCm39) missense possibly damaging 0.84
R8547:Adamts14 UTSW 10 61,106,998 (GRCm39) missense probably damaging 1.00
R8797:Adamts14 UTSW 10 61,106,781 (GRCm39) missense probably benign 0.44
R8978:Adamts14 UTSW 10 61,038,795 (GRCm39) missense probably damaging 0.96
R9023:Adamts14 UTSW 10 61,038,780 (GRCm39) missense probably damaging 1.00
R9067:Adamts14 UTSW 10 61,085,439 (GRCm39) missense possibly damaging 0.78
R9326:Adamts14 UTSW 10 61,036,238 (GRCm39) missense probably benign 0.00
R9641:Adamts14 UTSW 10 61,106,829 (GRCm39) missense probably damaging 1.00
R9785:Adamts14 UTSW 10 61,049,427 (GRCm39) missense possibly damaging 0.83
Z1088:Adamts14 UTSW 10 61,054,224 (GRCm39) missense probably damaging 1.00
Z1177:Adamts14 UTSW 10 61,034,622 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CCTGGGAGAGACCATTTCAAAG -3'
(R):5'- TGGTTTGCAGAGAGCTCCTG -3'

Sequencing Primer
(F):5'- TGGGAGAGACCATTTCAAAGTATACC -3'
(R):5'- AGAGAGCTCCTGGGTGGTC -3'
Posted On 2017-03-31