Mutagenetix > Incidental Mutation

Incidental Mutation 'R5953:Adamts14'

471011

Institutional Source

Beutler Lab

Gene Symbol

Adamts14

Ensembl Gene

ENSMUSG00000059901

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14

Synonyms

Adamts-14, TS14

MMRRC Submission

043245-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5953 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61197112-61273438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61207446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 751 (T751A)

Ref Sequence

ENSEMBL: ENSMUSP00000112723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]

AlphaFold

E9PX39

Predicted Effect

probably damaging
Transcript: ENSMUST00000092486
AA Change: T748A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: T748A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	38	194	6.3e-30	PFAM
Pfam:Reprolysin_5	245	424	6e-17	PFAM
Pfam:Reprolysin_4	246	432	2.5e-7	PFAM
Pfam:Reprolysin	246	447	1.9e-21	PFAM
Pfam:Reprolysin_2	264	437	9.2e-10	PFAM
Pfam:Reprolysin_3	268	396	2.5e-12	PFAM
TSP1	542	594	5.9e-16	SMART
Pfam:ADAM_spacer1	701	816	1.8e-24	PFAM
TSP1	837	894	2.1e-2	SMART
TSP1	897	956	3.42e-3	SMART
TSP1	959	1009	4.48e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120336
AA Change: T751A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: T751A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	194	1.6e-38	PFAM
Pfam:Reprolysin_5	245	427	5.9e-16	PFAM
Pfam:Reprolysin_4	246	435	1.1e-7	PFAM
Pfam:Reprolysin	246	450	3.2e-20	PFAM
Pfam:Reprolysin_2	264	441	5.5e-12	PFAM
Pfam:Reprolysin_3	268	399	1.5e-13	PFAM
TSP1	545	597	5.9e-16	SMART
Pfam:ADAM_spacer1	704	819	8e-25	PFAM
TSP1	840	897	2.1e-2	SMART
TSP1	900	959	3.42e-3	SMART
TSP1	962	1012	4.48e-7	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	A	7: 120,361,018	S675T	probably damaging	Het
Acvr2a	T	C	2: 48,890,404	L212P	probably damaging	Het
Adgrf2	T	C	17: 42,710,338	N532D	probably damaging	Het
Asns	T	C	6: 7,682,285	E220G	probably benign	Het
Cd209d	A	T	8: 3,877,979		probably null	Het
Cenpp	T	C	13: 49,652,685	D2G	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Clec4a3	G	T	6: 122,969,492	V232L	probably benign	Het
Cntln	C	T	4: 85,049,919	H792Y	possibly damaging	Het
Cobl	T	A	11: 12,256,220	T470S	probably benign	Het
Cym	T	A	3: 107,213,467	D274V	probably damaging	Het
Elac2	G	A	11: 64,999,223	C627Y	probably benign	Het
Emc7	T	A	2: 112,459,558	I111N	probably damaging	Het
Eya4	T	A	10: 23,151,973	Y310F	probably damaging	Het
Fam217b	C	T	2: 178,420,360	S39F	probably damaging	Het
Fam234b	G	T	6: 135,225,707	R353L	possibly damaging	Het
Focad	A	G	4: 88,229,335	I404V	probably benign	Het
Il1rl1	T	A	1: 40,442,673	D180E	probably benign	Het
Il2rb	A	T	15: 78,484,982	C256*	probably null	Het
Intu	A	C	3: 40,679,550	L404F	probably damaging	Het
Jmy	G	A	13: 93,499,116	T64M	possibly damaging	Het
Mpl	C	A	4: 118,454,510	S302I	possibly damaging	Het
Mpl	T	A	4: 118,454,511	S302C	probably damaging	Het
Muc2	G	T	7: 141,701,382	D241Y	probably damaging	Het
Nlrp3	C	T	11: 59,546,791	H99Y	probably benign	Het
Olfr1474	A	T	19: 13,471,368	I133F	possibly damaging	Het
Olfr812	C	G	10: 129,842,614	V143L	probably benign	Het
Pglyrp1	A	T	7: 18,890,313	I174F	probably damaging	Het
Pi4ka	A	T	16: 17,281,951	I1936N		Het
Plekhm3	C	T	1: 64,937,895	E139K	probably damaging	Het
Pomk	C	A	8: 25,983,048	L292F	probably damaging	Het
Ptpru	A	G	4: 131,776,837	I1103T	probably damaging	Het
Pygl	T	C	12: 70,219,627	D38G	probably damaging	Het
Rapsn	T	C	2: 91,041,963	V214A	probably benign	Het
S100a9	T	A	3: 90,692,927	K54M	probably damaging	Het
Sdk2	A	G	11: 113,793,744	Y1964H	probably damaging	Het
Slc17a5	T	C	9: 78,557,498	N331S	probably damaging	Het
Snx9	T	A	17: 5,908,402	C252S	probably damaging	Het
Snx9	G	T	17: 5,908,403	C252F	probably damaging	Het
Trem1	A	T	17: 48,237,192	M82L	probably benign	Het

Other mutations in Adamts14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Adamts14	APN	10	61229676	missense	probably damaging	1.00
IGL00800:Adamts14	APN	10	61205418	missense	probably benign	0.00
IGL01021:Adamts14	APN	10	61225373	missense	probably damaging	0.99
IGL01022:Adamts14	APN	10	61202942	missense	probably benign	0.01
IGL01335:Adamts14	APN	10	61198681	missense	possibly damaging	0.90
IGL01419:Adamts14	APN	10	61205542	splice site	probably benign
IGL01595:Adamts14	APN	10	61205473	missense	probably damaging	1.00
R0594:Adamts14	UTSW	10	61202887	missense	probably damaging	1.00
R0629:Adamts14	UTSW	10	61211624	nonsense	probably null
R1459:Adamts14	UTSW	10	61198804	missense	probably benign	0.13
R1565:Adamts14	UTSW	10	61270897	missense	probably damaging	1.00
R1686:Adamts14	UTSW	10	61198660	missense	probably benign
R1792:Adamts14	UTSW	10	61218498	missense	probably benign	0.07
R1876:Adamts14	UTSW	10	61200372	missense	probably benign	0.03
R1992:Adamts14	UTSW	10	61198660	missense	probably benign
R2064:Adamts14	UTSW	10	61205522	missense	probably benign	0.24
R2495:Adamts14	UTSW	10	61198970	splice site	probably null
R2848:Adamts14	UTSW	10	61218435	missense	probably damaging	1.00
R2897:Adamts14	UTSW	10	61204910	missense	probably damaging	0.99
R3428:Adamts14	UTSW	10	61224374	missense	probably benign	0.36
R4006:Adamts14	UTSW	10	61202821	critical splice donor site	probably null
R5129:Adamts14	UTSW	10	61249618	missense	probably benign	0.02
R5327:Adamts14	UTSW	10	61198488	missense	probably benign	0.01
R5524:Adamts14	UTSW	10	61230443	missense	probably damaging	1.00
R5594:Adamts14	UTSW	10	61227101	splice site	probably null
R5694:Adamts14	UTSW	10	61229652	missense	probably benign	0.45
R5801:Adamts14	UTSW	10	61202996	missense	probably damaging	0.99
R5941:Adamts14	UTSW	10	61221895	missense	probably damaging	1.00
R6778:Adamts14	UTSW	10	61225452	missense	probably damaging	1.00
R7169:Adamts14	UTSW	10	61204928	missense	probably damaging	0.97
R7215:Adamts14	UTSW	10	61211596	missense	possibly damaging	0.89
R7337:Adamts14	UTSW	10	61207460	missense	probably damaging	0.98
R7511:Adamts14	UTSW	10	61218528	missense	possibly damaging	0.74
R7640:Adamts14	UTSW	10	61246057	missense	probably benign	0.00
R7798:Adamts14	UTSW	10	61271173	missense	probably damaging	0.99
R7902:Adamts14	UTSW	10	61205397	missense	possibly damaging	0.92
R8062:Adamts14	UTSW	10	61200361	critical splice donor site	probably null
R8284:Adamts14	UTSW	10	61198659	missense	possibly damaging	0.55
R8319:Adamts14	UTSW	10	61221927	missense	probably benign
R8475:Adamts14	UTSW	10	61202887	missense	probably damaging	1.00
R8494:Adamts14	UTSW	10	61202929	missense	probably benign	0.03
R8519:Adamts14	UTSW	10	61202840	missense	possibly damaging	0.84
R8547:Adamts14	UTSW	10	61271219	missense	probably damaging	1.00
R8797:Adamts14	UTSW	10	61271002	missense	probably benign	0.44
R8978:Adamts14	UTSW	10	61203016	missense	probably damaging	0.96
R9023:Adamts14	UTSW	10	61203001	missense	probably damaging	1.00
R9067:Adamts14	UTSW	10	61249660	missense	possibly damaging	0.78
R9326:Adamts14	UTSW	10	61200459	missense	probably benign	0.00
R9641:Adamts14	UTSW	10	61271050	missense	probably damaging	1.00
R9785:Adamts14	UTSW	10	61213648	missense	possibly damaging	0.83
Z1088:Adamts14	UTSW	10	61218445	missense	probably damaging	1.00
Z1177:Adamts14	UTSW	10	61198843	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- CCTGGGAGAGACCATTTCAAAG -3'
(R):5'- TGGTTTGCAGAGAGCTCCTG -3'

Sequencing Primer
(F):5'- TGGGAGAGACCATTTCAAAGTATACC -3'
(R):5'- AGAGAGCTCCTGGGTGGTC -3'

Posted On

2017-03-31