Incidental Mutation 'R5953:Olfr812'
List |< first << previous [record 28 of 41] next >> last >|
ID471012
Institutional Source Beutler Lab
Gene Symbol Olfr812
Ensembl Gene ENSMUSG00000049052
Gene Nameolfactory receptor 812
SynonymsGA_x6K02T2PULF-11521598-11520666, MOR110-1
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129841418-129846094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 129842614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 143 (V143L)
Ref Sequence ENSEMBL: ENSMUSP00000145482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057775] [ENSMUST00000203571] [ENSMUST00000205013]
Predicted Effect probably benign
Transcript: ENSMUST00000057775
AA Change: V143L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053359
Gene: ENSMUSG00000049052
AA Change: V143L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203571
AA Change: V143L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145284
Gene: ENSMUSG00000049052
AA Change: V143L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.3e-50 PFAM
Pfam:7tm_1 39 288 9.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205013
AA Change: V143L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: V143L

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Olfr812
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr812 APN 10 129842473 missense probably damaging 1.00
IGL01637:Olfr812 APN 10 129842610 missense probably benign 0.14
IGL02035:Olfr812 APN 10 129842790 missense possibly damaging 0.95
IGL02546:Olfr812 APN 10 129842547 missense probably damaging 0.97
R1902:Olfr812 UTSW 10 129842506 missense probably benign
R4583:Olfr812 UTSW 10 129842475 missense probably damaging 1.00
R4598:Olfr812 UTSW 10 129842995 missense possibly damaging 0.92
R4714:Olfr812 UTSW 10 129842945 missense probably damaging 0.99
R5196:Olfr812 UTSW 10 129842781 missense possibly damaging 0.90
R6311:Olfr812 UTSW 10 129842907 missense possibly damaging 0.88
R6356:Olfr812 UTSW 10 129842608 missense probably benign 0.14
R6499:Olfr812 UTSW 10 129842584 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGCTGAGCTGAAGGGAAC -3'
(R):5'- CCAGGTTCCTGATAAGCATTCTC -3'

Sequencing Primer
(F):5'- AACTTTAGGATGGTTTTGATGATGAG -3'
(R):5'- CCTGATAAGCATTCTCTCAGGAG -3'
Posted On2017-03-31