Incidental Mutation 'R5953:Cobl'
ID 471013
Institutional Source Beutler Lab
Gene Symbol Cobl
Ensembl Gene ENSMUSG00000020173
Gene Name cordon-bleu WH2 repeat
Synonyms C530045F18Rik
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 12186676-12415022 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12206220 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 470 (T470S)
Ref Sequence ENSEMBL: ENSMUSP00000105277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]
AlphaFold Q5NBX1
Predicted Effect probably benign
Transcript: ENSMUST00000046755
AA Change: T552S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: T552S

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 144 235 2.2e-46 PFAM
low complexity region 328 333 N/A INTRINSIC
low complexity region 360 376 N/A INTRINSIC
low complexity region 408 433 N/A INTRINSIC
low complexity region 468 482 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
coiled coil region 564 589 N/A INTRINSIC
WH2 1185 1205 1.32e0 SMART
WH2 1225 1245 6.36e-3 SMART
low complexity region 1276 1296 N/A INTRINSIC
WH2 1313 1333 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109650
AA Change: T470S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: T470S

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.6e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
coiled coil region 482 507 N/A INTRINSIC
WH2 1103 1123 1.32e0 SMART
WH2 1143 1163 6.36e-3 SMART
low complexity region 1194 1214 N/A INTRINSIC
WH2 1231 1251 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109651
AA Change: T527S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: T527S

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 1.2e-40 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
low complexity region 383 408 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
coiled coil region 539 564 N/A INTRINSIC
WH2 1160 1180 1.32e0 SMART
WH2 1200 1220 6.36e-3 SMART
low complexity region 1251 1271 N/A INTRINSIC
WH2 1288 1308 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172919
SMART Domains Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.6e-41 PFAM
low complexity region 328 333 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000172956
SMART Domains Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
Pfam:Cobl 182 260 2.4e-41 PFAM
low complexity region 303 308 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174874
AA Change: T545S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: T545S

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
Pfam:Cobl 175 253 1.2e-40 PFAM
low complexity region 321 326 N/A INTRINSIC
low complexity region 353 369 N/A INTRINSIC
low complexity region 401 426 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
low complexity region 519 534 N/A INTRINSIC
coiled coil region 557 582 N/A INTRINSIC
WH2 1178 1198 1.32e0 SMART
WH2 1218 1238 6.36e-3 SMART
low complexity region 1269 1289 N/A INTRINSIC
WH2 1306 1326 3.91e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Cobl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cobl APN 11 12,325,813 (GRCm39) missense possibly damaging 0.89
IGL00698:Cobl APN 11 12,203,722 (GRCm39) missense probably benign 0.41
IGL00772:Cobl APN 11 12,216,985 (GRCm39) missense probably benign 0.02
IGL00922:Cobl APN 11 12,204,866 (GRCm39) missense probably damaging 1.00
IGL00985:Cobl APN 11 12,204,843 (GRCm39) missense probably damaging 1.00
IGL01641:Cobl APN 11 12,259,641 (GRCm39) nonsense probably null
IGL01722:Cobl APN 11 12,203,987 (GRCm39) missense probably benign 0.00
IGL01734:Cobl APN 11 12,204,980 (GRCm39) splice site probably benign
IGL01924:Cobl APN 11 12,204,596 (GRCm39) missense probably benign 0.30
IGL02105:Cobl APN 11 12,199,651 (GRCm39) missense probably damaging 1.00
IGL02326:Cobl APN 11 12,336,712 (GRCm39) missense possibly damaging 0.69
IGL02342:Cobl APN 11 12,203,672 (GRCm39) missense possibly damaging 0.64
IGL02426:Cobl APN 11 12,204,351 (GRCm39) nonsense probably null
IGL02754:Cobl APN 11 12,204,370 (GRCm39) missense probably damaging 1.00
IGL02754:Cobl APN 11 12,204,371 (GRCm39) missense probably damaging 1.00
IGL02811:Cobl APN 11 12,203,285 (GRCm39) missense possibly damaging 0.56
IGL02859:Cobl APN 11 12,319,602 (GRCm39) missense probably damaging 1.00
IGL02999:Cobl APN 11 12,293,869 (GRCm39) missense possibly damaging 0.71
IGL03030:Cobl APN 11 12,204,241 (GRCm39) missense possibly damaging 0.80
IGL03191:Cobl APN 11 12,203,364 (GRCm39) missense probably benign 0.00
PIT4418001:Cobl UTSW 11 12,206,240 (GRCm39) missense possibly damaging 0.79
PIT4480001:Cobl UTSW 11 12,203,592 (GRCm39) missense probably benign
PIT4495001:Cobl UTSW 11 12,204,596 (GRCm39) missense probably benign 0.00
R0031:Cobl UTSW 11 12,204,945 (GRCm39) missense probably benign 0.36
R0241:Cobl UTSW 11 12,204,524 (GRCm39) missense probably benign 0.25
R0241:Cobl UTSW 11 12,204,524 (GRCm39) missense probably benign 0.25
R0322:Cobl UTSW 11 12,217,072 (GRCm39) missense probably damaging 1.00
R0597:Cobl UTSW 11 12,204,699 (GRCm39) missense probably benign 0.24
R0733:Cobl UTSW 11 12,315,167 (GRCm39) missense probably benign 0.31
R0734:Cobl UTSW 11 12,325,971 (GRCm39) missense probably damaging 1.00
R0784:Cobl UTSW 11 12,216,843 (GRCm39) splice site probably benign
R0884:Cobl UTSW 11 12,325,908 (GRCm39) missense possibly damaging 0.89
R1065:Cobl UTSW 11 12,204,327 (GRCm39) missense possibly damaging 0.67
R1331:Cobl UTSW 11 12,325,853 (GRCm39) missense probably damaging 0.96
R1892:Cobl UTSW 11 12,203,258 (GRCm39) missense probably damaging 0.99
R2847:Cobl UTSW 11 12,328,342 (GRCm39) missense probably damaging 1.00
R2848:Cobl UTSW 11 12,328,342 (GRCm39) missense probably damaging 1.00
R3407:Cobl UTSW 11 12,325,830 (GRCm39) missense probably damaging 1.00
R4627:Cobl UTSW 11 12,201,093 (GRCm39) missense probably damaging 1.00
R4662:Cobl UTSW 11 12,203,672 (GRCm39) missense probably benign 0.08
R4677:Cobl UTSW 11 12,336,665 (GRCm39) missense possibly damaging 0.93
R4844:Cobl UTSW 11 12,204,740 (GRCm39) missense probably benign 0.10
R4942:Cobl UTSW 11 12,204,185 (GRCm39) missense probably damaging 0.99
R5158:Cobl UTSW 11 12,206,198 (GRCm39) missense possibly damaging 0.84
R5195:Cobl UTSW 11 12,203,565 (GRCm39) missense probably benign 0.02
R5255:Cobl UTSW 11 12,325,825 (GRCm39) missense probably damaging 1.00
R5588:Cobl UTSW 11 12,293,886 (GRCm39) nonsense probably null
R5637:Cobl UTSW 11 12,246,531 (GRCm39) intron probably benign
R5643:Cobl UTSW 11 12,256,948 (GRCm39) splice site probably benign
R5749:Cobl UTSW 11 12,216,965 (GRCm39) missense possibly damaging 0.86
R6000:Cobl UTSW 11 12,319,684 (GRCm39) missense probably benign 0.08
R6373:Cobl UTSW 11 12,203,118 (GRCm39) missense probably damaging 1.00
R7034:Cobl UTSW 11 12,204,177 (GRCm39) missense probably damaging 1.00
R7071:Cobl UTSW 11 12,204,795 (GRCm39) missense probably benign 0.00
R7077:Cobl UTSW 11 12,203,441 (GRCm39) missense probably benign 0.04
R7078:Cobl UTSW 11 12,328,271 (GRCm39) missense probably damaging 1.00
R7099:Cobl UTSW 11 12,246,540 (GRCm39) missense
R7153:Cobl UTSW 11 12,204,128 (GRCm39) missense probably damaging 1.00
R7448:Cobl UTSW 11 12,206,225 (GRCm39) missense possibly damaging 0.46
R7519:Cobl UTSW 11 12,203,124 (GRCm39) missense probably damaging 1.00
R7767:Cobl UTSW 11 12,362,117 (GRCm39) start gained probably benign
R7772:Cobl UTSW 11 12,204,488 (GRCm39) missense probably benign 0.29
R7841:Cobl UTSW 11 12,203,324 (GRCm39) missense probably damaging 1.00
R7845:Cobl UTSW 11 12,315,139 (GRCm39) missense probably benign 0.35
R8026:Cobl UTSW 11 12,203,459 (GRCm39) missense probably benign 0.01
R8118:Cobl UTSW 11 12,204,834 (GRCm39) missense probably benign 0.03
R8192:Cobl UTSW 11 12,199,745 (GRCm39) missense probably benign 0.07
R8320:Cobl UTSW 11 12,217,001 (GRCm39) missense probably damaging 1.00
R8338:Cobl UTSW 11 12,203,696 (GRCm39) missense probably benign 0.41
R9319:Cobl UTSW 11 12,203,648 (GRCm39) missense probably benign 0.00
R9497:Cobl UTSW 11 12,203,501 (GRCm39) missense probably benign 0.00
R9501:Cobl UTSW 11 12,328,235 (GRCm39) missense possibly damaging 0.94
Z1176:Cobl UTSW 11 12,325,827 (GRCm39) missense probably damaging 1.00
Z1176:Cobl UTSW 11 12,319,645 (GRCm39) missense probably damaging 1.00
Z1176:Cobl UTSW 11 12,203,433 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGCAAACCCAAGACTTCTTTC -3'
(R):5'- CTGCATGGACTTCAGCTGTTG -3'

Sequencing Primer
(F):5'- GCAAACCCAAGACTTCTTTCTTATAG -3'
(R):5'- CTGCATGGACTTCAGCTGTTGATAAC -3'
Posted On 2017-03-31