Incidental Mutation 'R5953:Elac2'
ID 471015
Institutional Source Beutler Lab
Gene Symbol Elac2
Ensembl Gene ENSMUSG00000020549
Gene Name elaC ribonuclease Z 2
Synonyms tRNase Z(L), D11Wsu80e, 1110017O07Rik
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 64869864-64892895 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 64890049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 627 (C627Y)
Ref Sequence ENSEMBL: ENSMUSP00000104337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000071891] [ENSMUST00000093002] [ENSMUST00000101049] [ENSMUST00000108697]
AlphaFold Q80Y81
Predicted Effect probably benign
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071891
AA Change: C628Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071788
Gene: ENSMUSG00000020549
AA Change: C628Y

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 1.5e-16 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101049
AA Change: C628Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098610
Gene: ENSMUSG00000020549
AA Change: C628Y

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 3.1e-17 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108697
AA Change: C627Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104337
Gene: ENSMUSG00000020549
AA Change: C627Y

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 9.8e-19 PFAM
Lactamase_B 493 697 1.75e0 SMART
low complexity region 771 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140369
Predicted Effect probably benign
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a C-terminal domain with tRNA 3′ processing endoribonuclease activity, which catalyzes the removal of the 3' trailer from precursor tRNAs. The protein also interacts with activated Smad family member 2 (Smad2) and its nuclear partner forkhead box H1 (also known as FAST-1), and reduced expression can suppress transforming growth factor-beta induced growth arrest. Mutations in this gene result in an increased risk of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Pygl T C 12: 70,266,401 (GRCm39) D38G probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Elac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Elac2 APN 11 64,871,476 (GRCm39) missense possibly damaging 0.92
IGL02035:Elac2 APN 11 64,892,661 (GRCm39) missense probably benign
IGL02407:Elac2 APN 11 64,890,001 (GRCm39) missense probably benign 0.01
R0329:Elac2 UTSW 11 64,870,136 (GRCm39) missense probably damaging 1.00
R0360:Elac2 UTSW 11 64,870,136 (GRCm39) missense probably damaging 1.00
R0364:Elac2 UTSW 11 64,870,136 (GRCm39) missense probably damaging 1.00
R0526:Elac2 UTSW 11 64,890,262 (GRCm39) missense probably benign 0.07
R0729:Elac2 UTSW 11 64,889,349 (GRCm39) missense possibly damaging 0.62
R1912:Elac2 UTSW 11 64,885,089 (GRCm39) missense probably benign
R1929:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign 0.00
R2345:Elac2 UTSW 11 64,891,900 (GRCm39) missense probably damaging 0.99
R4765:Elac2 UTSW 11 64,883,048 (GRCm39) missense probably damaging 1.00
R4828:Elac2 UTSW 11 64,886,153 (GRCm39) missense probably damaging 1.00
R5000:Elac2 UTSW 11 64,876,379 (GRCm39) missense probably benign
R5109:Elac2 UTSW 11 64,883,142 (GRCm39) missense probably damaging 1.00
R5391:Elac2 UTSW 11 64,885,120 (GRCm39) missense probably benign
R5865:Elac2 UTSW 11 64,888,783 (GRCm39) missense probably benign 0.39
R6800:Elac2 UTSW 11 64,890,265 (GRCm39) critical splice donor site probably null
R6829:Elac2 UTSW 11 64,880,190 (GRCm39) missense probably benign
R6870:Elac2 UTSW 11 64,890,589 (GRCm39) missense probably null 1.00
R7037:Elac2 UTSW 11 64,874,537 (GRCm39) missense probably benign
R7869:Elac2 UTSW 11 64,890,213 (GRCm39) missense probably damaging 0.99
R8087:Elac2 UTSW 11 64,870,034 (GRCm39) missense probably benign 0.14
R8139:Elac2 UTSW 11 64,871,440 (GRCm39) missense probably benign 0.28
R8559:Elac2 UTSW 11 64,872,502 (GRCm39) critical splice donor site probably null
R9197:Elac2 UTSW 11 64,892,682 (GRCm39) missense probably benign
R9211:Elac2 UTSW 11 64,869,864 (GRCm39) unclassified probably benign
R9291:Elac2 UTSW 11 64,883,142 (GRCm39) missense probably damaging 1.00
X0020:Elac2 UTSW 11 64,878,284 (GRCm39) missense probably damaging 0.96
Z1186:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Z1187:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Z1188:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Z1189:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Z1190:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Z1191:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Z1192:Elac2 UTSW 11 64,870,015 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCTAGCTCTTCTCATTGATCAG -3'
(R):5'- AGACGACTTTCCAGCCAGATG -3'

Sequencing Primer
(F):5'- GTCACAATTCTCAGAACCACTTAAGG -3'
(R):5'- TTCCAGCCAGATGAATGTACCAGTG -3'
Posted On 2017-03-31