Incidental Mutation 'R5953:Elac2'
ID471015
Institutional Source Beutler Lab
Gene Symbol Elac2
Ensembl Gene ENSMUSG00000020549
Gene NameelaC ribonuclease Z 2
Synonyms1110017O07Rik, tRNase Z(L), D11Wsu80e
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location64979038-65002069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64999223 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 627 (C627Y)
Ref Sequence ENSEMBL: ENSMUSP00000104337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000071891] [ENSMUST00000093002] [ENSMUST00000101049] [ENSMUST00000108697]
Predicted Effect probably benign
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071891
AA Change: C628Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071788
Gene: ENSMUSG00000020549
AA Change: C628Y

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 1.5e-16 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101049
AA Change: C628Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098610
Gene: ENSMUSG00000020549
AA Change: C628Y

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 3.1e-17 PFAM
Lactamase_B 494 698 1.75e0 SMART
low complexity region 772 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108697
AA Change: C627Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104337
Gene: ENSMUSG00000020549
AA Change: C627Y

DomainStartEndE-ValueType
Pfam:Lactamase_B_4 53 112 9.8e-19 PFAM
Lactamase_B 493 697 1.75e0 SMART
low complexity region 771 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128693
Predicted Effect probably benign
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140369
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a C-terminal domain with tRNA 3′ processing endoribonuclease activity, which catalyzes the removal of the 3' trailer from precursor tRNAs. The protein also interacts with activated Smad family member 2 (Smad2) and its nuclear partner forkhead box H1 (also known as FAST-1), and reduced expression can suppress transforming growth factor-beta induced growth arrest. Mutations in this gene result in an increased risk of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Elac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Elac2 APN 11 64980650 missense possibly damaging 0.92
IGL02035:Elac2 APN 11 65001835 missense probably benign
IGL02407:Elac2 APN 11 64999175 missense probably benign 0.01
R0329:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0360:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0364:Elac2 UTSW 11 64979310 missense probably damaging 1.00
R0526:Elac2 UTSW 11 64999436 missense probably benign 0.07
R0729:Elac2 UTSW 11 64998523 missense possibly damaging 0.62
R1912:Elac2 UTSW 11 64994263 missense probably benign
R1929:Elac2 UTSW 11 64979189 missense probably benign 0.00
R2345:Elac2 UTSW 11 65001074 missense probably damaging 0.99
R4765:Elac2 UTSW 11 64992222 missense probably damaging 1.00
R4828:Elac2 UTSW 11 64995327 missense probably damaging 1.00
R5000:Elac2 UTSW 11 64985553 missense probably benign
R5109:Elac2 UTSW 11 64992316 missense probably damaging 1.00
R5391:Elac2 UTSW 11 64994294 missense probably benign
R5865:Elac2 UTSW 11 64997957 missense probably benign 0.39
R6800:Elac2 UTSW 11 64999439 critical splice donor site probably null
R6829:Elac2 UTSW 11 64989364 missense probably benign
R6870:Elac2 UTSW 11 64999763 missense probably null 1.00
R7037:Elac2 UTSW 11 64983711 missense probably benign
R7869:Elac2 UTSW 11 64999387 missense probably damaging 0.99
R8087:Elac2 UTSW 11 64979208 missense probably benign 0.14
R8139:Elac2 UTSW 11 64980614 missense probably benign 0.28
X0020:Elac2 UTSW 11 64987458 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCCTAGCTCTTCTCATTGATCAG -3'
(R):5'- AGACGACTTTCCAGCCAGATG -3'

Sequencing Primer
(F):5'- GTCACAATTCTCAGAACCACTTAAGG -3'
(R):5'- TTCCAGCCAGATGAATGTACCAGTG -3'
Posted On2017-03-31