Incidental Mutation 'R5953:Pygl'
ID471018
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Nameliver glycogen phosphorylase
Synonyms
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70190811-70231488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70219627 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 38 (D38G)
Ref Sequence ENSEMBL: ENSMUSP00000125585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
Predicted Effect probably damaging
Transcript: ENSMUST00000071250
AA Change: D129G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: D129G

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161083
AA Change: D38G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: D38G

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166609
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70191092 missense probably damaging 1.00
IGL00903:Pygl APN 12 70207742 missense probably damaging 1.00
IGL01965:Pygl APN 12 70191114 missense probably benign 0.00
IGL02347:Pygl APN 12 70201892 missense probably benign 0.14
IGL02403:Pygl APN 12 70194258 missense probably benign
IGL02501:Pygl APN 12 70191134 missense probably benign 0.05
IGL02727:Pygl APN 12 70207668 splice site probably null
IGL03125:Pygl APN 12 70197482 missense probably damaging 1.00
IGL03158:Pygl APN 12 70195675 missense probably damaging 1.00
IGL03202:Pygl APN 12 70199646 missense probably benign
IGL03368:Pygl APN 12 70191152 missense probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0524:Pygl UTSW 12 70207724 missense probably damaging 1.00
R0883:Pygl UTSW 12 70206404 missense probably damaging 0.97
R0894:Pygl UTSW 12 70194374 splice site probably benign
R0905:Pygl UTSW 12 70211017 splice site probably benign
R1494:Pygl UTSW 12 70199730 missense probably damaging 0.98
R1621:Pygl UTSW 12 70191092 missense probably damaging 1.00
R1647:Pygl UTSW 12 70197010 missense possibly damaging 0.60
R3082:Pygl UTSW 12 70197529 missense probably damaging 1.00
R3845:Pygl UTSW 12 70198443 missense probably benign 0.12
R3876:Pygl UTSW 12 70201339 missense probably damaging 1.00
R4358:Pygl UTSW 12 70195690 missense probably damaging 1.00
R4614:Pygl UTSW 12 70210979 splice site probably null
R4707:Pygl UTSW 12 70207758 missense possibly damaging 0.69
R4908:Pygl UTSW 12 70197033 missense probably null
R4940:Pygl UTSW 12 70206381 missense probably damaging 1.00
R5077:Pygl UTSW 12 70201892 missense probably benign 0.14
R5186:Pygl UTSW 12 70201344 missense probably damaging 1.00
R5726:Pygl UTSW 12 70191142 nonsense probably null
R5957:Pygl UTSW 12 70199720 missense probably damaging 0.99
R6020:Pygl UTSW 12 70216654 missense probably damaging 1.00
R6024:Pygl UTSW 12 70197067 missense probably benign 0.09
R7050:Pygl UTSW 12 70219622 missense probably damaging 1.00
R7159:Pygl UTSW 12 70197406 missense probably benign 0.41
R7194:Pygl UTSW 12 70194320 missense probably benign
R7283:Pygl UTSW 12 70216568 missense possibly damaging 0.92
R7360:Pygl UTSW 12 70227532 missense probably benign 0.11
R7446:Pygl UTSW 12 70197010 missense probably benign
R7637:Pygl UTSW 12 70197795 splice site probably null
R7886:Pygl UTSW 12 70206356 splice site probably null
R8054:Pygl UTSW 12 70227339 critical splice donor site probably null
Z1176:Pygl UTSW 12 70222874 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCGTCTACAGTAGGGACATG -3'
(R):5'- TTGTACCACTGGCACCAATG -3'

Sequencing Primer
(F):5'- ACAGTAGGGACATGCTTTCTC -3'
(R):5'- TGGCACCAATGATTGCTAGC -3'
Posted On2017-03-31