Incidental Mutation 'R5953:Pygl'
ID 471018
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Name liver glycogen phosphorylase
Synonyms
MMRRC Submission 043245-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.586) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 70237589-70274457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70266401 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 38 (D38G)
Ref Sequence ENSEMBL: ENSMUSP00000125585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
AlphaFold Q9ET01
Predicted Effect probably damaging
Transcript: ENSMUST00000071250
AA Change: D129G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: D129G

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161083
AA Change: D38G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: D38G

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166609
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 119,960,241 (GRCm39) S675T probably damaging Het
Acvr2a T C 2: 48,780,416 (GRCm39) L212P probably damaging Het
Adamts14 T C 10: 61,043,225 (GRCm39) T751A probably damaging Het
Adgrf2 T C 17: 43,021,229 (GRCm39) N532D probably damaging Het
Asns T C 6: 7,682,285 (GRCm39) E220G probably benign Het
Cd209d A T 8: 3,927,979 (GRCm39) probably null Het
Cenpp T C 13: 49,806,161 (GRCm39) D2G probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Clec4a3 G T 6: 122,946,451 (GRCm39) V232L probably benign Het
Cntln C T 4: 84,968,156 (GRCm39) H792Y possibly damaging Het
Cobl T A 11: 12,206,220 (GRCm39) T470S probably benign Het
Cym T A 3: 107,120,783 (GRCm39) D274V probably damaging Het
Elac2 G A 11: 64,890,049 (GRCm39) C627Y probably benign Het
Emc7 T A 2: 112,289,903 (GRCm39) I111N probably damaging Het
Eya4 T A 10: 23,027,871 (GRCm39) Y310F probably damaging Het
Fam217b C T 2: 178,062,153 (GRCm39) S39F probably damaging Het
Fam234b G T 6: 135,202,705 (GRCm39) R353L possibly damaging Het
Focad A G 4: 88,147,572 (GRCm39) I404V probably benign Het
Il1rl1 T A 1: 40,481,833 (GRCm39) D180E probably benign Het
Il2rb A T 15: 78,369,182 (GRCm39) C256* probably null Het
Intu A C 3: 40,633,980 (GRCm39) L404F probably damaging Het
Jmy G A 13: 93,635,624 (GRCm39) T64M possibly damaging Het
Mpl C A 4: 118,311,707 (GRCm39) S302I possibly damaging Het
Mpl T A 4: 118,311,708 (GRCm39) S302C probably damaging Het
Muc2 G T 7: 141,287,951 (GRCm39) D241Y probably damaging Het
Nlrp3 C T 11: 59,437,617 (GRCm39) H99Y probably benign Het
Or5b118 A T 19: 13,448,732 (GRCm39) I133F possibly damaging Het
Or6c216 C G 10: 129,678,483 (GRCm39) V143L probably benign Het
Pglyrp1 A T 7: 18,624,238 (GRCm39) I174F probably damaging Het
Pi4ka A T 16: 17,099,815 (GRCm39) I1936N Het
Plekhm3 C T 1: 64,977,054 (GRCm39) E139K probably damaging Het
Pomk C A 8: 26,473,076 (GRCm39) L292F probably damaging Het
Ptpru A G 4: 131,504,148 (GRCm39) I1103T probably damaging Het
Rapsn T C 2: 90,872,308 (GRCm39) V214A probably benign Het
S100a9 T A 3: 90,600,234 (GRCm39) K54M probably damaging Het
Sdk2 A G 11: 113,684,570 (GRCm39) Y1964H probably damaging Het
Slc17a5 T C 9: 78,464,780 (GRCm39) N331S probably damaging Het
Snx9 T A 17: 5,958,677 (GRCm39) C252S probably damaging Het
Snx9 G T 17: 5,958,678 (GRCm39) C252F probably damaging Het
Trem1 A T 17: 48,544,220 (GRCm39) M82L probably benign Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70,237,866 (GRCm39) missense probably damaging 1.00
IGL00903:Pygl APN 12 70,254,516 (GRCm39) missense probably damaging 1.00
IGL01965:Pygl APN 12 70,237,888 (GRCm39) missense probably benign 0.00
IGL02347:Pygl APN 12 70,248,666 (GRCm39) missense probably benign 0.14
IGL02403:Pygl APN 12 70,241,032 (GRCm39) missense probably benign
IGL02501:Pygl APN 12 70,237,908 (GRCm39) missense probably benign 0.05
IGL02727:Pygl APN 12 70,254,442 (GRCm39) splice site probably null
IGL03125:Pygl APN 12 70,244,256 (GRCm39) missense probably damaging 1.00
IGL03158:Pygl APN 12 70,242,449 (GRCm39) missense probably damaging 1.00
IGL03202:Pygl APN 12 70,246,420 (GRCm39) missense probably benign
IGL03368:Pygl APN 12 70,237,926 (GRCm39) missense probably benign
R0096:Pygl UTSW 12 70,237,940 (GRCm39) splice site probably benign
R0096:Pygl UTSW 12 70,237,940 (GRCm39) splice site probably benign
R0524:Pygl UTSW 12 70,254,498 (GRCm39) missense probably damaging 1.00
R0883:Pygl UTSW 12 70,253,178 (GRCm39) missense probably damaging 0.97
R0894:Pygl UTSW 12 70,241,148 (GRCm39) splice site probably benign
R0905:Pygl UTSW 12 70,257,791 (GRCm39) splice site probably benign
R1494:Pygl UTSW 12 70,246,504 (GRCm39) missense probably damaging 0.98
R1621:Pygl UTSW 12 70,237,866 (GRCm39) missense probably damaging 1.00
R1647:Pygl UTSW 12 70,243,784 (GRCm39) missense possibly damaging 0.60
R3082:Pygl UTSW 12 70,244,303 (GRCm39) missense probably damaging 1.00
R3845:Pygl UTSW 12 70,245,217 (GRCm39) missense probably benign 0.12
R3876:Pygl UTSW 12 70,248,113 (GRCm39) missense probably damaging 1.00
R4358:Pygl UTSW 12 70,242,464 (GRCm39) missense probably damaging 1.00
R4614:Pygl UTSW 12 70,257,753 (GRCm39) splice site probably null
R4707:Pygl UTSW 12 70,254,532 (GRCm39) missense possibly damaging 0.69
R4908:Pygl UTSW 12 70,243,807 (GRCm39) missense probably null
R4940:Pygl UTSW 12 70,253,155 (GRCm39) missense probably damaging 1.00
R5077:Pygl UTSW 12 70,248,666 (GRCm39) missense probably benign 0.14
R5186:Pygl UTSW 12 70,248,118 (GRCm39) missense probably damaging 1.00
R5726:Pygl UTSW 12 70,237,916 (GRCm39) nonsense probably null
R5957:Pygl UTSW 12 70,246,494 (GRCm39) missense probably damaging 0.99
R6020:Pygl UTSW 12 70,263,428 (GRCm39) missense probably damaging 1.00
R6024:Pygl UTSW 12 70,243,841 (GRCm39) missense probably benign 0.09
R7050:Pygl UTSW 12 70,266,396 (GRCm39) missense probably damaging 1.00
R7159:Pygl UTSW 12 70,244,180 (GRCm39) missense probably benign 0.41
R7194:Pygl UTSW 12 70,241,094 (GRCm39) missense probably benign
R7283:Pygl UTSW 12 70,263,342 (GRCm39) missense possibly damaging 0.92
R7360:Pygl UTSW 12 70,274,306 (GRCm39) missense probably benign 0.11
R7446:Pygl UTSW 12 70,243,784 (GRCm39) missense probably benign
R7637:Pygl UTSW 12 70,244,569 (GRCm39) splice site probably null
R7886:Pygl UTSW 12 70,253,130 (GRCm39) splice site probably null
R8054:Pygl UTSW 12 70,274,113 (GRCm39) critical splice donor site probably null
R8693:Pygl UTSW 12 70,244,180 (GRCm39) missense probably benign 0.41
R8753:Pygl UTSW 12 70,242,400 (GRCm39) missense probably damaging 1.00
R8803:Pygl UTSW 12 70,242,390 (GRCm39) missense probably damaging 1.00
R8842:Pygl UTSW 12 70,274,368 (GRCm39) intron probably benign
R9192:Pygl UTSW 12 70,243,822 (GRCm39) missense probably damaging 0.99
R9221:Pygl UTSW 12 70,242,401 (GRCm39) missense probably damaging 1.00
R9437:Pygl UTSW 12 70,246,925 (GRCm39) missense probably damaging 1.00
R9750:Pygl UTSW 12 70,245,303 (GRCm39) missense possibly damaging 0.68
Z1176:Pygl UTSW 12 70,269,648 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCGTCTACAGTAGGGACATG -3'
(R):5'- TTGTACCACTGGCACCAATG -3'

Sequencing Primer
(F):5'- ACAGTAGGGACATGCTTTCTC -3'
(R):5'- TGGCACCAATGATTGCTAGC -3'
Posted On 2017-03-31