Incidental Mutation 'R5953:Cenpp'
ID471019
Institutional Source Beutler Lab
Gene Symbol Cenpp
Ensembl Gene ENSMUSG00000021391
Gene Namecentromere protein P
Synonyms1700022C02Rik, 4921518G09Rik
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R5953 (G1)
Quality Score113
Status Not validated
Chromosome13
Chromosomal Location49464023-49652785 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49652685 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000021818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]
Predicted Effect probably damaging
Transcript: ENSMUST00000021818
AA Change: D2G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391
AA Change: D2G

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021824
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
Predicted Effect probably benign
Transcript: ENSMUST00000221142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Predicted Effect probably benign
Transcript: ENSMUST00000222197
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect probably benign
Transcript: ENSMUST00000223264
Predicted Effect probably benign
Transcript: ENSMUST00000223467
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Cenpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Cenpp APN 13 49647656 critical splice acceptor site probably null
IGL01323:Cenpp APN 13 49647642 missense probably damaging 1.00
IGL01397:Cenpp APN 13 49641283 missense probably damaging 1.00
IGL01553:Cenpp APN 13 49464776 missense probably damaging 0.99
IGL02489:Cenpp APN 13 49650118 splice site probably null
IGL03024:Cenpp APN 13 49464254 missense probably benign 0.16
R0218:Cenpp UTSW 13 49647632 missense possibly damaging 0.57
R0660:Cenpp UTSW 13 49464697 missense probably benign 0.00
R1868:Cenpp UTSW 13 49641283 missense probably damaging 1.00
R4097:Cenpp UTSW 13 49493789 missense possibly damaging 0.88
R4377:Cenpp UTSW 13 49494431 utr 3 prime probably benign
R4595:Cenpp UTSW 13 49641234 missense probably benign 0.09
R5173:Cenpp UTSW 13 49464782 frame shift probably null
R5174:Cenpp UTSW 13 49464782 frame shift probably null
R7054:Cenpp UTSW 13 49465757 missense probably damaging 0.97
RF023:Cenpp UTSW 13 49650144 missense probably benign 0.00
Z1088:Cenpp UTSW 13 49647658 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATAAGGTTGAGAGGTCCGCG -3'
(R):5'- TTGGAACGAACCAACTCGCAG -3'

Sequencing Primer
(F):5'- GGGGTGCTACAGGGCATG -3'
(R):5'- GGGTGTCTAGACGCTCGAC -3'
Posted On2017-03-31