Incidental Mutation 'R5953:Il2rb'
ID 471021
Institutional Source Beutler Lab
Gene Symbol Il2rb
Ensembl Gene ENSMUSG00000068227
Gene Name interleukin 2 receptor, beta chain
Synonyms IL-15 receptor beta chain, CD122, IL-15Rbeta, IL15Rbeta, IL-2/15Rbeta, Il-2Rbeta
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R5953 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78479256-78495271 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 78484982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 256 (C256*)
Ref Sequence ENSEMBL: ENSMUSP00000127006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089398] [ENSMUST00000163494]
AlphaFold P16297
Predicted Effect probably null
Transcript: ENSMUST00000089398
AA Change: C256*
SMART Domains Protein: ENSMUSP00000086820
Gene: ENSMUSG00000068227
AA Change: C256*

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163494
AA Change: C256*
SMART Domains Protein: ENSMUSP00000127006
Gene: ENSMUSG00000068227
AA Change: C256*

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
FN3 133 219 9.48e-3 SMART
transmembrane domain 246 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: The interleukin 2 receptor is composed of alpha and beta subunits. The beta subunit encoded by this gene is very homologous to the human beta subunit and also shows structural similarity to other cytokine receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous activation of T cells and differentiation of B cells, elevated immunoglobulins including autoantibodies causing hemolytic anemia, granulocytopoiesis, and death after 3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Il2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Il2rb APN 15 78481697 missense probably benign 0.00
Bonnerhall UTSW 15 78485004 missense probably benign
diptera UTSW 15 78485806 missense probably damaging 1.00
flybase UTSW 15 78491848 start codon destroyed probably null 0.66
Halfmeasure UTSW 15 78486481 missense probably benign 0.04
Moonpie UTSW 15 78481834 frame shift probably null
tetragonal UTSW 15 78485753 missense probably benign
Whistles UTSW 15 78481936 missense possibly damaging 0.72
R0581:Il2rb UTSW 15 78481936 missense possibly damaging 0.72
R1795:Il2rb UTSW 15 78483987 missense probably damaging 1.00
R1932:Il2rb UTSW 15 78491777 missense possibly damaging 0.93
R2924:Il2rb UTSW 15 78491849 start codon destroyed probably null 0.27
R4706:Il2rb UTSW 15 78486400 missense possibly damaging 0.81
R5713:Il2rb UTSW 15 78491848 start codon destroyed probably null 0.66
R6018:Il2rb UTSW 15 78482066 missense possibly damaging 0.54
R6279:Il2rb UTSW 15 78481538 missense possibly damaging 0.72
R6666:Il2rb UTSW 15 78481834 frame shift probably null
R6961:Il2rb UTSW 15 78485824 missense probably damaging 1.00
R8020:Il2rb UTSW 15 78485004 missense probably benign
R8477:Il2rb UTSW 15 78485806 missense probably damaging 1.00
R8854:Il2rb UTSW 15 78485753 missense probably benign
R8976:Il2rb UTSW 15 78486481 missense probably benign 0.04
R8979:Il2rb UTSW 15 78491852 start gained probably benign
R9509:Il2rb UTSW 15 78490216 missense probably damaging 0.97
R9541:Il2rb UTSW 15 78488193 missense probably benign 0.00
R9745:Il2rb UTSW 15 78488199 missense probably benign 0.00
X0018:Il2rb UTSW 15 78485765 missense probably damaging 1.00
X0066:Il2rb UTSW 15 78484956 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGCTTCTACCTGTGGGATG -3'
(R):5'- GCAAAAGCAAGCCTGGCTAG -3'

Sequencing Primer
(F):5'- CTTCTACCTGTGGGATGAGGCAC -3'
(R):5'- AAGCCTGGCTAGACACTGGTAC -3'
Posted On 2017-03-31