Incidental Mutation 'R5953:Trem1'
ID471026
Institutional Source Beutler Lab
Gene Symbol Trem1
Ensembl Gene ENSMUSG00000042265
Gene Nametriggering receptor expressed on myeloid cells 1
Synonyms
MMRRC Submission 043245-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location48232768-48246924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48237192 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 82 (M82L)
Ref Sequence ENSEMBL: ENSMUSP00000038636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048782] [ENSMUST00000113251]
PDB Structure
Crystal Structure of Mouse Triggering Receptor Expressed on Myeloid Cells 1 (TREM-1) at 1.76 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048782
AA Change: M82L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038636
Gene: ENSMUSG00000042265
AA Change: M82L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 134 1.25e-4 SMART
low complexity region 159 170 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113251
SMART Domains Protein: ENSMUSP00000108877
Gene: ENSMUSG00000042265

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
transmembrane domain 83 105 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit decreased susceptibility to DEN induced tumors and liver damage. Mice homozygous for a knock-out allele of Trem1 and Trem3 exhibit increased susceptibility to P. aeruginosa infection with reduced neutrophil transepithelial migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr1474 A T 19: 13,471,368 I133F possibly damaging Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Other mutations in Trem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Trem1 APN 17 48237249 missense probably benign 0.14
IGL01729:Trem1 APN 17 48244575 missense possibly damaging 0.90
IGL01756:Trem1 APN 17 48237113 nonsense probably null
IGL02348:Trem1 APN 17 48232796 start codon destroyed probably null 1.00
IGL02720:Trem1 APN 17 48232841 missense probably benign 0.03
R0589:Trem1 UTSW 17 48237217 missense possibly damaging 0.93
R1807:Trem1 UTSW 17 48241635 nonsense probably null
R1878:Trem1 UTSW 17 48241488 missense possibly damaging 0.83
R4648:Trem1 UTSW 17 48244562 missense probably benign 0.10
R5121:Trem1 UTSW 17 48232836 missense probably null 0.00
R5387:Trem1 UTSW 17 48241513 missense possibly damaging 0.92
R5623:Trem1 UTSW 17 48237055 missense probably damaging 1.00
R6538:Trem1 UTSW 17 48237090 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCTGCCATTGTTCTAGAGGAAG -3'
(R):5'- TAGCTCCATTCATGTCTGGC -3'

Sequencing Primer
(F):5'- CTGCCATTGTTCTAGAGGAAGAAAGG -3'
(R):5'- ATTCATGTCTGGCCCTCTCTG -3'
Posted On2017-03-31