Incidental Mutation 'R5953:Olfr1474'
ID471027
Institutional Source Beutler Lab
Gene Symbol Olfr1474
Ensembl Gene ENSMUSG00000096273
Gene Nameolfactory receptor 1474
SynonymsMOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527
MMRRC Submission 043245-MU
Accession Numbers

Genbank: NM_001011842.1

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5953 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13469565-13472157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13471368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 133 (I133F)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096202
AA Change: I133F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: I133F

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207529
AA Change: I91F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220113
AA Change: I133F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,361,018 S675T probably damaging Het
Acvr2a T C 2: 48,890,404 L212P probably damaging Het
Adamts14 T C 10: 61,207,446 T751A probably damaging Het
Adgrf2 T C 17: 42,710,338 N532D probably damaging Het
Asns T C 6: 7,682,285 E220G probably benign Het
Cd209d A T 8: 3,877,979 probably null Het
Cenpp T C 13: 49,652,685 D2G probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Clec4a3 G T 6: 122,969,492 V232L probably benign Het
Cntln C T 4: 85,049,919 H792Y possibly damaging Het
Cobl T A 11: 12,256,220 T470S probably benign Het
Cym T A 3: 107,213,467 D274V probably damaging Het
Elac2 G A 11: 64,999,223 C627Y probably benign Het
Emc7 T A 2: 112,459,558 I111N probably damaging Het
Eya4 T A 10: 23,151,973 Y310F probably damaging Het
Fam217b C T 2: 178,420,360 S39F probably damaging Het
Fam234b G T 6: 135,225,707 R353L possibly damaging Het
Focad A G 4: 88,229,335 I404V probably benign Het
Il1rl1 T A 1: 40,442,673 D180E probably benign Het
Il2rb A T 15: 78,484,982 C256* probably null Het
Intu A C 3: 40,679,550 L404F probably damaging Het
Jmy G A 13: 93,499,116 T64M possibly damaging Het
Mpl C A 4: 118,454,510 S302I possibly damaging Het
Mpl T A 4: 118,454,511 S302C probably damaging Het
Muc2 G T 7: 141,701,382 D241Y probably damaging Het
Nlrp3 C T 11: 59,546,791 H99Y probably benign Het
Olfr812 C G 10: 129,842,614 V143L probably benign Het
Pglyrp1 A T 7: 18,890,313 I174F probably damaging Het
Pi4ka A T 16: 17,281,951 I1936N probably damaging Het
Plekhm3 C T 1: 64,937,895 E139K probably damaging Het
Pomk C A 8: 25,983,048 L292F probably damaging Het
Ptpru A G 4: 131,776,837 I1103T probably damaging Het
Pygl T C 12: 70,219,627 D38G probably damaging Het
Rapsn T C 2: 91,041,963 V214A probably benign Het
S100a9 T A 3: 90,692,927 K54M probably damaging Het
Sdk2 A G 11: 113,793,744 Y1964H probably damaging Het
Slc17a5 T C 9: 78,557,498 N331S probably damaging Het
Snx9 T A 17: 5,908,402 C252S probably damaging Het
Snx9 G T 17: 5,908,403 C252F probably damaging Het
Trem1 A T 17: 48,237,192 M82L probably benign Het
Other mutations in Olfr1474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Olfr1474 APN 19 13471267 missense probably damaging 0.99
D605:Olfr1474 UTSW 19 13471157 nonsense probably null
R0173:Olfr1474 UTSW 19 13471701 missense probably benign 0.02
R1102:Olfr1474 UTSW 19 13471407 missense probably damaging 0.97
R1515:Olfr1474 UTSW 19 13471680 missense probably damaging 0.97
R1780:Olfr1474 UTSW 19 13471362 missense probably benign 0.14
R2061:Olfr1474 UTSW 19 13471241 missense probably damaging 0.98
R4016:Olfr1474 UTSW 19 13471197 missense possibly damaging 0.95
R4485:Olfr1474 UTSW 19 13471555 missense probably benign 0.08
R5119:Olfr1474 UTSW 19 13471546 missense probably benign 0.00
R5150:Olfr1474 UTSW 19 13471430 missense probably benign 0.01
R5156:Olfr1474 UTSW 19 13471673 missense probably damaging 1.00
R5699:Olfr1474 UTSW 19 13470972 start codon destroyed probably null 0.78
R5800:Olfr1474 UTSW 19 13471896 missense probably benign 0.06
R5840:Olfr1474 UTSW 19 13471878 missense probably benign 0.01
R5997:Olfr1474 UTSW 19 13471506 missense probably benign 0.12
R6233:Olfr1474 UTSW 19 13471740 missense probably damaging 1.00
R6488:Olfr1474 UTSW 19 13471617 missense probably damaging 1.00
R6847:Olfr1474 UTSW 19 13471038 missense probably benign 0.03
R6964:Olfr1474 UTSW 19 13471361 nonsense probably null
R7214:Olfr1474 UTSW 19 13470973 start codon destroyed probably null 1.00
R8001:Olfr1474 UTSW 19 13471422 missense probably benign 0.03
R8035:Olfr1474 UTSW 19 13471899 missense probably benign
R8129:Olfr1474 UTSW 19 13471144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTGTGTTTATGCCTCAGC -3'
(R):5'- GCCAAGACGAGCAGTGTAATC -3'

Sequencing Primer
(F):5'- TCAGCAATCACCCCCAAGG -3'
(R):5'- GACGAGCAGTGTAATCTCATTTG -3'
Posted On2017-03-31