Incidental Mutation 'R5955:2810006K23Rik'
ID471110
Institutional Source Beutler Lab
Gene Symbol 2810006K23Rik
Ensembl Gene ENSMUSG00000047635
Gene NameRIKEN cDNA 2810006K23 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.504) question?
Stock #R5955 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124328089-124341844 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 124340774 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 153 (E153*)
Ref Sequence ENSEMBL: ENSMUSP00000076594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031341] [ENSMUST00000077376] [ENSMUST00000111472] [ENSMUST00000111473] [ENSMUST00000111474] [ENSMUST00000111477]
PDB Structure Solution structure and siRNA-mediated knockdown analysis of the mitochondrial disease-related protein C12orf65 (ICT2) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031341
SMART Domains Protein: ENSMUSP00000031341
Gene: ENSMUSG00000029394

DomainStartEndE-ValueType
Pfam:CDK2AP 3 113 1.2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077376
AA Change: E153*
SMART Domains Protein: ENSMUSP00000076594
Gene: ENSMUSG00000047635
AA Change: E153*

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:RF-1 51 174 7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111472
SMART Domains Protein: ENSMUSP00000107097
Gene: ENSMUSG00000029394

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111473
SMART Domains Protein: ENSMUSP00000107098
Gene: ENSMUSG00000029394

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111474
SMART Domains Protein: ENSMUSP00000107099
Gene: ENSMUSG00000029394

DomainStartEndE-ValueType
Pfam:CDK2AP 1 87 9.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111477
SMART Domains Protein: ENSMUSP00000107102
Gene: ENSMUSG00000047635

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:RF-1 51 106 7.1e-15 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a mitochondrial matrix protein that appears to contribute to peptide chain termination in the mitochondrial translation machinery. Two different 1 bp deletions (resulting in the same premature stop codon)result in decreased mitochondrial translation, decreased levels of oxidative phosphorylation complexes and encepthalomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,813,190 D632V probably damaging Het
Acbd6 C T 1: 155,587,459 A135V probably benign Het
Adam26a A T 8: 43,569,852 F200L probably benign Het
Ago3 A T 4: 126,355,050 N569K probably damaging Het
Ak9 A T 10: 41,358,564 L640F probably damaging Het
Ampd2 A G 3: 108,079,772 V178A probably damaging Het
Anapc4 C G 5: 52,865,946 H710D probably benign Het
Atad2 T C 15: 58,105,659 I495V probably benign Het
Bhmt2 T C 13: 93,663,197 T244A probably benign Het
Capg T C 6: 72,555,500 V16A probably benign Het
Capn13 A G 17: 73,331,002 F469L possibly damaging Het
Ccdc149 C T 5: 52,376,535 V430I probably benign Het
Cma1 A C 14: 55,943,769 Y47D probably benign Het
Col6a3 A T 1: 90,811,441 L355Q probably damaging Het
Crocc G T 4: 141,017,918 T1796K possibly damaging Het
Cyp2c50 A T 19: 40,090,943 probably null Het
Dsp T C 13: 38,194,958 I1294T possibly damaging Het
Erbin A T 13: 103,830,192 F1250Y probably benign Het
Fbn1 A C 2: 125,358,882 C1298W probably damaging Het
Fbn2 A C 18: 58,044,256 F1990V probably damaging Het
Fez2 A T 17: 78,387,043 V306D probably damaging Het
Gigyf1 G A 5: 137,523,507 probably null Het
Gjb4 A T 4: 127,351,952 Y65* probably null Het
Gm26661 G A 14: 7,791,776 A64T unknown Het
Igkv1-135 T C 6: 67,610,279 S45P possibly damaging Het
Il27 T C 7: 126,594,898 T5A probably benign Het
Il27ra T C 8: 84,040,822 D124G probably benign Het
Itgad A G 7: 128,189,481 H424R probably benign Het
Itgal T C 7: 127,304,989 V258A possibly damaging Het
Kpna4 A G 3: 69,089,801 V351A probably benign Het
Lama5 T C 2: 180,197,474 Q747R probably damaging Het
Map4k5 A G 12: 69,844,390 F168L probably damaging Het
Mecom A G 3: 29,961,046 Y843H probably damaging Het
Mical3 T C 6: 121,033,750 M424V probably damaging Het
Myb A G 10: 21,152,499 I155T probably damaging Het
Nbea A T 3: 55,680,983 V2445E probably benign Het
Nlrp1b A T 11: 71,217,865 I270N probably damaging Het
Nlrp4f A T 13: 65,195,081 M250K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Olfr692 C T 7: 105,368,569 A72V probably damaging Het
P4ha1 A G 10: 59,342,796 S96G probably benign Het
Pcnt G T 10: 76,411,622 N1025K possibly damaging Het
Phactr4 A G 4: 132,386,909 F58S probably damaging Het
Phlpp1 T A 1: 106,364,230 probably null Het
Rab40c A C 17: 25,884,657 V144G probably damaging Het
Rnasel A G 1: 153,754,400 I221V probably benign Het
Rps6kb1 T C 11: 86,513,605 K241E probably damaging Het
Rrbp1 C G 2: 143,949,677 E1370Q probably benign Het
Rttn T C 18: 89,121,009 Y2111H probably damaging Het
Samd8 A G 14: 21,793,084 H364R probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Setdb1 A G 3: 95,338,842 Y590H probably damaging Het
Shkbp1 T C 7: 27,342,524 N635S probably benign Het
Tdgf1 C A 9: 110,944,213 R18L unknown Het
Tmem246 T C 4: 49,586,613 E185G probably damaging Het
Trpm6 A G 19: 18,892,019 D1990G possibly damaging Het
Usp48 A G 4: 137,615,818 N426S probably benign Het
Vmn2r16 G A 5: 109,363,747 V607M possibly damaging Het
Xdh A T 17: 73,898,320 V1050D probably damaging Het
Zfp110 C T 7: 12,848,745 T440I possibly damaging Het
Other mutations in 2810006K23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
Discipline UTSW 5 124340774 nonsense probably null
R5102:2810006K23Rik UTSW 5 124338891 missense probably damaging 1.00
R6005:2810006K23Rik UTSW 5 124340774 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGTGCCACCAAACAAG -3'
(R):5'- AAAAGGTTCTTAAGAGGATTTGTGT -3'

Sequencing Primer
(F):5'- GTGCCACCAAACAAGATCTGTGG -3'
(R):5'- GACCTGAGTCTTCTGCAAGAACTG -3'
Posted On2017-03-31