Incidental Mutation 'R5955:Zfp110'
ID471116
Institutional Source Beutler Lab
Gene Symbol Zfp110
Ensembl Gene ENSMUSG00000058638
Gene Namezinc finger protein 110
SynonymsNrif1, NRIF, 2900024E01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R5955 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12834761-12850577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12848745 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 440 (T440I)
Ref Sequence ENSEMBL: ENSMUSP00000132060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004614] [ENSMUST00000168247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004614
AA Change: T440I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004614
Gene: ENSMUSG00000058638
AA Change: T440I

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137718
Predicted Effect possibly damaging
Transcript: ENSMUST00000168247
AA Change: T440I

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132060
Gene: ENSMUSG00000058638
AA Change: T440I

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants on a C57BL/6 background die at embryonic day 12. On a strain 129 background, mutants are viable and fertile, but males are more docile and testis weight is greatly reduced. On an F2 background, 20% of homozygous pups die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
Abcc2 A T 19: 43,813,190 D632V probably damaging Het
Acbd6 C T 1: 155,587,459 A135V probably benign Het
Adam26a A T 8: 43,569,852 F200L probably benign Het
Ago3 A T 4: 126,355,050 N569K probably damaging Het
Ak9 A T 10: 41,358,564 L640F probably damaging Het
Ampd2 A G 3: 108,079,772 V178A probably damaging Het
Anapc4 C G 5: 52,865,946 H710D probably benign Het
Atad2 T C 15: 58,105,659 I495V probably benign Het
Bhmt2 T C 13: 93,663,197 T244A probably benign Het
Capg T C 6: 72,555,500 V16A probably benign Het
Capn13 A G 17: 73,331,002 F469L possibly damaging Het
Ccdc149 C T 5: 52,376,535 V430I probably benign Het
Cma1 A C 14: 55,943,769 Y47D probably benign Het
Col6a3 A T 1: 90,811,441 L355Q probably damaging Het
Crocc G T 4: 141,017,918 T1796K possibly damaging Het
Cyp2c50 A T 19: 40,090,943 probably null Het
Dsp T C 13: 38,194,958 I1294T possibly damaging Het
Erbin A T 13: 103,830,192 F1250Y probably benign Het
Fbn1 A C 2: 125,358,882 C1298W probably damaging Het
Fbn2 A C 18: 58,044,256 F1990V probably damaging Het
Fez2 A T 17: 78,387,043 V306D probably damaging Het
Gigyf1 G A 5: 137,523,507 probably null Het
Gjb4 A T 4: 127,351,952 Y65* probably null Het
Gm26661 G A 14: 7,791,776 A64T unknown Het
Igkv1-135 T C 6: 67,610,279 S45P possibly damaging Het
Il27 T C 7: 126,594,898 T5A probably benign Het
Il27ra T C 8: 84,040,822 D124G probably benign Het
Itgad A G 7: 128,189,481 H424R probably benign Het
Itgal T C 7: 127,304,989 V258A possibly damaging Het
Kpna4 A G 3: 69,089,801 V351A probably benign Het
Lama5 T C 2: 180,197,474 Q747R probably damaging Het
Map4k5 A G 12: 69,844,390 F168L probably damaging Het
Mecom A G 3: 29,961,046 Y843H probably damaging Het
Mical3 T C 6: 121,033,750 M424V probably damaging Het
Myb A G 10: 21,152,499 I155T probably damaging Het
Nbea A T 3: 55,680,983 V2445E probably benign Het
Nlrp1b A T 11: 71,217,865 I270N probably damaging Het
Nlrp4f A T 13: 65,195,081 M250K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Olfr692 C T 7: 105,368,569 A72V probably damaging Het
P4ha1 A G 10: 59,342,796 S96G probably benign Het
Pcnt G T 10: 76,411,622 N1025K possibly damaging Het
Phactr4 A G 4: 132,386,909 F58S probably damaging Het
Phlpp1 T A 1: 106,364,230 probably null Het
Rab40c A C 17: 25,884,657 V144G probably damaging Het
Rnasel A G 1: 153,754,400 I221V probably benign Het
Rps6kb1 T C 11: 86,513,605 K241E probably damaging Het
Rrbp1 C G 2: 143,949,677 E1370Q probably benign Het
Rttn T C 18: 89,121,009 Y2111H probably damaging Het
Samd8 A G 14: 21,793,084 H364R probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Setdb1 A G 3: 95,338,842 Y590H probably damaging Het
Shkbp1 T C 7: 27,342,524 N635S probably benign Het
Tdgf1 C A 9: 110,944,213 R18L unknown Het
Tmem246 T C 4: 49,586,613 E185G probably damaging Het
Trpm6 A G 19: 18,892,019 D1990G possibly damaging Het
Usp48 A G 4: 137,615,818 N426S probably benign Het
Vmn2r16 G A 5: 109,363,747 V607M possibly damaging Het
Xdh A T 17: 73,898,320 V1050D probably damaging Het
Other mutations in Zfp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp110 APN 7 12849159 missense probably benign 0.38
IGL01094:Zfp110 APN 7 12849796 missense probably damaging 1.00
IGL01576:Zfp110 APN 7 12849671 missense probably damaging 1.00
IGL01859:Zfp110 APN 7 12849540 missense possibly damaging 0.86
IGL02003:Zfp110 APN 7 12849905 nonsense probably null
R0122:Zfp110 UTSW 7 12848597 missense possibly damaging 0.51
R0357:Zfp110 UTSW 7 12836375 missense probably damaging 0.98
R0383:Zfp110 UTSW 7 12849260 missense probably benign 0.00
R0725:Zfp110 UTSW 7 12836363 missense possibly damaging 0.52
R0926:Zfp110 UTSW 7 12849881 nonsense probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1472:Zfp110 UTSW 7 12848541 missense possibly damaging 0.85
R1663:Zfp110 UTSW 7 12848642 missense probably benign 0.08
R1975:Zfp110 UTSW 7 12848502 missense probably benign 0.00
R2046:Zfp110 UTSW 7 12849422 missense probably benign 0.00
R2296:Zfp110 UTSW 7 12849540 missense probably damaging 0.97
R2341:Zfp110 UTSW 7 12849186 missense probably benign 0.04
R4332:Zfp110 UTSW 7 12844571 nonsense probably null
R5892:Zfp110 UTSW 7 12848478 missense probably benign 0.00
R6083:Zfp110 UTSW 7 12844675 missense possibly damaging 0.95
R6115:Zfp110 UTSW 7 12849774 missense probably damaging 0.98
R7187:Zfp110 UTSW 7 12849826 nonsense probably null
R7455:Zfp110 UTSW 7 12848057 missense probably benign
R7570:Zfp110 UTSW 7 12849340 missense possibly damaging 0.94
R7727:Zfp110 UTSW 7 12848995 missense possibly damaging 0.91
R7895:Zfp110 UTSW 7 12837093 missense possibly damaging 0.86
R8179:Zfp110 UTSW 7 12844571 nonsense probably null
R8703:Zfp110 UTSW 7 12848961 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGTCAAAGAAATGCACACC -3'
(R):5'- CTTTCTGGTAAACTTTTGCAGGC -3'

Sequencing Primer
(F):5'- TCAAATCAAGTGGGGAATCTACAG -3'
(R):5'- AACTTTTGCAGGCACAGTAAG -3'
Posted On2017-03-31