Incidental Mutation 'R5955:Olfr1'
ID471133
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5955 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73395654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
Abcc2 A T 19: 43,813,190 D632V probably damaging Het
Acbd6 C T 1: 155,587,459 A135V probably benign Het
Adam26a A T 8: 43,569,852 F200L probably benign Het
Ago3 A T 4: 126,355,050 N569K probably damaging Het
Ak9 A T 10: 41,358,564 L640F probably damaging Het
Ampd2 A G 3: 108,079,772 V178A probably damaging Het
Anapc4 C G 5: 52,865,946 H710D probably benign Het
Atad2 T C 15: 58,105,659 I495V probably benign Het
Bhmt2 T C 13: 93,663,197 T244A probably benign Het
Capg T C 6: 72,555,500 V16A probably benign Het
Capn13 A G 17: 73,331,002 F469L possibly damaging Het
Ccdc149 C T 5: 52,376,535 V430I probably benign Het
Cma1 A C 14: 55,943,769 Y47D probably benign Het
Col6a3 A T 1: 90,811,441 L355Q probably damaging Het
Crocc G T 4: 141,017,918 T1796K possibly damaging Het
Cyp2c50 A T 19: 40,090,943 probably null Het
Dsp T C 13: 38,194,958 I1294T possibly damaging Het
Erbin A T 13: 103,830,192 F1250Y probably benign Het
Fbn1 A C 2: 125,358,882 C1298W probably damaging Het
Fbn2 A C 18: 58,044,256 F1990V probably damaging Het
Fez2 A T 17: 78,387,043 V306D probably damaging Het
Gigyf1 G A 5: 137,523,507 probably null Het
Gjb4 A T 4: 127,351,952 Y65* probably null Het
Gm26661 G A 14: 7,791,776 A64T unknown Het
Igkv1-135 T C 6: 67,610,279 S45P possibly damaging Het
Il27 T C 7: 126,594,898 T5A probably benign Het
Il27ra T C 8: 84,040,822 D124G probably benign Het
Itgad A G 7: 128,189,481 H424R probably benign Het
Itgal T C 7: 127,304,989 V258A possibly damaging Het
Kpna4 A G 3: 69,089,801 V351A probably benign Het
Lama5 T C 2: 180,197,474 Q747R probably damaging Het
Map4k5 A G 12: 69,844,390 F168L probably damaging Het
Mecom A G 3: 29,961,046 Y843H probably damaging Het
Mical3 T C 6: 121,033,750 M424V probably damaging Het
Myb A G 10: 21,152,499 I155T probably damaging Het
Nbea A T 3: 55,680,983 V2445E probably benign Het
Nlrp1b A T 11: 71,217,865 I270N probably damaging Het
Nlrp4f A T 13: 65,195,081 M250K probably benign Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Olfr692 C T 7: 105,368,569 A72V probably damaging Het
P4ha1 A G 10: 59,342,796 S96G probably benign Het
Pcnt G T 10: 76,411,622 N1025K possibly damaging Het
Phactr4 A G 4: 132,386,909 F58S probably damaging Het
Phlpp1 T A 1: 106,364,230 probably null Het
Rab40c A C 17: 25,884,657 V144G probably damaging Het
Rnasel A G 1: 153,754,400 I221V probably benign Het
Rps6kb1 T C 11: 86,513,605 K241E probably damaging Het
Rrbp1 C G 2: 143,949,677 E1370Q probably benign Het
Rttn T C 18: 89,121,009 Y2111H probably damaging Het
Samd8 A G 14: 21,793,084 H364R probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Setdb1 A G 3: 95,338,842 Y590H probably damaging Het
Shkbp1 T C 7: 27,342,524 N635S probably benign Het
Tdgf1 C A 9: 110,944,213 R18L unknown Het
Tmem246 T C 4: 49,586,613 E185G probably damaging Het
Trpm6 A G 19: 18,892,019 D1990G possibly damaging Het
Usp48 A G 4: 137,615,818 N426S probably benign Het
Vmn2r16 G A 5: 109,363,747 V607M possibly damaging Het
Xdh A T 17: 73,898,320 V1050D probably damaging Het
Zfp110 C T 7: 12,848,745 T440I possibly damaging Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4171:Olfr1 UTSW 11 73395539 missense probably damaging 1.00
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
R7530:Olfr1 UTSW 11 73388363 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CATTAACACGGGTGTCAGAGC -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On2017-03-31