Incidental Mutation 'R5955:Cma1'
ID471143
Institutional Source Beutler Lab
Gene Symbol Cma1
Ensembl Gene ENSMUSG00000022225
Gene Namechymase 1, mast cell
SynonymsMcp-5, MMCP-5, Mcpt5, Mcp5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5955 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55941451-55944675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55943769 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 47 (Y47D)
Ref Sequence ENSEMBL: ENSMUSP00000154406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022834] [ENSMUST00000226280]
Predicted Effect probably benign
Transcript: ENSMUST00000022834
AA Change: Y60D

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225
AA Change: Y60D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 34 253 4.85e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226280
AA Change: Y47D

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduction in mast cell-mediated ischemia reperfusion injury of skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810006K23Rik G T 5: 124,340,774 E153* probably null Het
Abcc2 A T 19: 43,813,190 D632V probably damaging Het
Acbd6 C T 1: 155,587,459 A135V probably benign Het
Adam26a A T 8: 43,569,852 F200L probably benign Het
Ago3 A T 4: 126,355,050 N569K probably damaging Het
Ak9 A T 10: 41,358,564 L640F probably damaging Het
Ampd2 A G 3: 108,079,772 V178A probably damaging Het
Anapc4 C G 5: 52,865,946 H710D probably benign Het
Atad2 T C 15: 58,105,659 I495V probably benign Het
Bhmt2 T C 13: 93,663,197 T244A probably benign Het
Capg T C 6: 72,555,500 V16A probably benign Het
Capn13 A G 17: 73,331,002 F469L possibly damaging Het
Ccdc149 C T 5: 52,376,535 V430I probably benign Het
Col6a3 A T 1: 90,811,441 L355Q probably damaging Het
Crocc G T 4: 141,017,918 T1796K possibly damaging Het
Cyp2c50 A T 19: 40,090,943 probably null Het
Dsp T C 13: 38,194,958 I1294T possibly damaging Het
Erbin A T 13: 103,830,192 F1250Y probably benign Het
Fbn1 A C 2: 125,358,882 C1298W probably damaging Het
Fbn2 A C 18: 58,044,256 F1990V probably damaging Het
Fez2 A T 17: 78,387,043 V306D probably damaging Het
Gigyf1 G A 5: 137,523,507 probably null Het
Gjb4 A T 4: 127,351,952 Y65* probably null Het
Gm26661 G A 14: 7,791,776 A64T unknown Het
Igkv1-135 T C 6: 67,610,279 S45P possibly damaging Het
Il27 T C 7: 126,594,898 T5A probably benign Het
Il27ra T C 8: 84,040,822 D124G probably benign Het
Itgad A G 7: 128,189,481 H424R probably benign Het
Itgal T C 7: 127,304,989 V258A possibly damaging Het
Kpna4 A G 3: 69,089,801 V351A probably benign Het
Lama5 T C 2: 180,197,474 Q747R probably damaging Het
Map4k5 A G 12: 69,844,390 F168L probably damaging Het
Mecom A G 3: 29,961,046 Y843H probably damaging Het
Mical3 T C 6: 121,033,750 M424V probably damaging Het
Myb A G 10: 21,152,499 I155T probably damaging Het
Nbea A T 3: 55,680,983 V2445E probably benign Het
Nlrp1b A T 11: 71,217,865 I270N probably damaging Het
Nlrp4f A T 13: 65,195,081 M250K probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr155 T A 4: 43,854,898 N196K probably damaging Het
Olfr692 C T 7: 105,368,569 A72V probably damaging Het
P4ha1 A G 10: 59,342,796 S96G probably benign Het
Pcnt G T 10: 76,411,622 N1025K possibly damaging Het
Phactr4 A G 4: 132,386,909 F58S probably damaging Het
Phlpp1 T A 1: 106,364,230 probably null Het
Rab40c A C 17: 25,884,657 V144G probably damaging Het
Rnasel A G 1: 153,754,400 I221V probably benign Het
Rps6kb1 T C 11: 86,513,605 K241E probably damaging Het
Rrbp1 C G 2: 143,949,677 E1370Q probably benign Het
Rttn T C 18: 89,121,009 Y2111H probably damaging Het
Samd8 A G 14: 21,793,084 H364R probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Setdb1 A G 3: 95,338,842 Y590H probably damaging Het
Shkbp1 T C 7: 27,342,524 N635S probably benign Het
Tdgf1 C A 9: 110,944,213 R18L unknown Het
Tmem246 T C 4: 49,586,613 E185G probably damaging Het
Trpm6 A G 19: 18,892,019 D1990G possibly damaging Het
Usp48 A G 4: 137,615,818 N426S probably benign Het
Vmn2r16 G A 5: 109,363,747 V607M possibly damaging Het
Xdh A T 17: 73,898,320 V1050D probably damaging Het
Zfp110 C T 7: 12,848,745 T440I possibly damaging Het
Other mutations in Cma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Cma1 APN 14 55942697 missense probably benign 0.26
IGL02797:Cma1 APN 14 55943814 missense possibly damaging 0.58
R0026:Cma1 UTSW 14 55942164 missense probably damaging 1.00
R2029:Cma1 UTSW 14 55943734 missense possibly damaging 0.81
R2060:Cma1 UTSW 14 55943698 critical splice donor site probably null
R4994:Cma1 UTSW 14 55941671 missense probably damaging 1.00
R5275:Cma1 UTSW 14 55941700 missense probably damaging 1.00
R5794:Cma1 UTSW 14 55944520 missense probably benign
R5824:Cma1 UTSW 14 55941725 missense possibly damaging 0.79
R5958:Cma1 UTSW 14 55941656 makesense probably null
R6075:Cma1 UTSW 14 55942314 missense probably damaging 0.97
R6139:Cma1 UTSW 14 55942700 critical splice acceptor site probably null
R7088:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7139:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7220:Cma1 UTSW 14 55942663 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTTGTCAGTTGACCTAGGCTC -3'
(R):5'- AGCTGACAGAGATGCCTGAG -3'

Sequencing Primer
(F):5'- TCAGTTGACCTAGGCTCAGGATC -3'
(R):5'- ATGCCTGAGAGAAGTATGGC -3'
Posted On2017-03-31