Incidental Mutation 'R5955:Xdh'
ID 471147
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R5955 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74205315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1050 (V1050D)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: V1050D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V1050D

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,801,629 (GRCm39) D632V probably damaging Het
Acbd6 C T 1: 155,463,205 (GRCm39) A135V probably benign Het
Adam26a A T 8: 44,022,889 (GRCm39) F200L probably benign Het
Ago3 A T 4: 126,248,843 (GRCm39) N569K probably damaging Het
Ak9 A T 10: 41,234,560 (GRCm39) L640F probably damaging Het
Ampd2 A G 3: 107,987,088 (GRCm39) V178A probably damaging Het
Anapc4 C G 5: 53,023,288 (GRCm39) H710D probably benign Het
Atad2 T C 15: 57,969,055 (GRCm39) I495V probably benign Het
Bhmt2 T C 13: 93,799,705 (GRCm39) T244A probably benign Het
Capg T C 6: 72,532,483 (GRCm39) V16A probably benign Het
Capn13 A G 17: 73,637,997 (GRCm39) F469L possibly damaging Het
Ccdc149 C T 5: 52,533,877 (GRCm39) V430I probably benign Het
Cma1 A C 14: 56,181,226 (GRCm39) Y47D probably benign Het
Col6a3 A T 1: 90,739,163 (GRCm39) L355Q probably damaging Het
Cripto C A 9: 110,773,281 (GRCm39) R18L unknown Het
Crocc G T 4: 140,745,229 (GRCm39) T1796K possibly damaging Het
Cyp2c50 A T 19: 40,079,387 (GRCm39) probably null Het
Dsp T C 13: 38,378,934 (GRCm39) I1294T possibly damaging Het
Erbin A T 13: 103,966,700 (GRCm39) F1250Y probably benign Het
Fbn1 A C 2: 125,200,802 (GRCm39) C1298W probably damaging Het
Fbn2 A C 18: 58,177,328 (GRCm39) F1990V probably damaging Het
Fez2 A T 17: 78,694,472 (GRCm39) V306D probably damaging Het
Gigyf1 G A 5: 137,521,769 (GRCm39) probably null Het
Gjb4 A T 4: 127,245,745 (GRCm39) Y65* probably null Het
Gm26661 G A 14: 7,791,776 (GRCm38) A64T unknown Het
Igkv1-135 T C 6: 67,587,263 (GRCm39) S45P possibly damaging Het
Il27 T C 7: 126,194,070 (GRCm39) T5A probably benign Het
Il27ra T C 8: 84,767,451 (GRCm39) D124G probably benign Het
Itgad A G 7: 127,788,653 (GRCm39) H424R probably benign Het
Itgal T C 7: 126,904,161 (GRCm39) V258A possibly damaging Het
Kpna4 A G 3: 68,997,134 (GRCm39) V351A probably benign Het
Lama5 T C 2: 179,839,267 (GRCm39) Q747R probably damaging Het
Map4k5 A G 12: 69,891,164 (GRCm39) F168L probably damaging Het
Mecom A G 3: 30,015,195 (GRCm39) Y843H probably damaging Het
Mical3 T C 6: 121,010,711 (GRCm39) M424V probably damaging Het
Mtrfr G T 5: 124,478,837 (GRCm39) E153* probably null Het
Myb A G 10: 21,028,398 (GRCm39) I155T probably damaging Het
Nbea A T 3: 55,588,404 (GRCm39) V2445E probably benign Het
Nlrp1b A T 11: 71,108,691 (GRCm39) I270N probably damaging Het
Nlrp4f A T 13: 65,342,895 (GRCm39) M250K probably benign Het
Or13c7 T A 4: 43,854,898 (GRCm39) N196K probably damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or52w1 C T 7: 105,017,776 (GRCm39) A72V probably damaging Het
P4ha1 A G 10: 59,178,618 (GRCm39) S96G probably benign Het
Pcnt G T 10: 76,247,456 (GRCm39) N1025K possibly damaging Het
Pgap4 T C 4: 49,586,613 (GRCm39) E185G probably damaging Het
Phactr4 A G 4: 132,114,220 (GRCm39) F58S probably damaging Het
Phlpp1 T A 1: 106,291,960 (GRCm39) probably null Het
Rab40c A C 17: 26,103,631 (GRCm39) V144G probably damaging Het
Rnasel A G 1: 153,630,146 (GRCm39) I221V probably benign Het
Rps6kb1 T C 11: 86,404,431 (GRCm39) K241E probably damaging Het
Rrbp1 C G 2: 143,791,597 (GRCm39) E1370Q probably benign Het
Rttn T C 18: 89,139,133 (GRCm39) Y2111H probably damaging Het
Samd8 A G 14: 21,843,152 (GRCm39) H364R probably damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Setdb1 A G 3: 95,246,153 (GRCm39) Y590H probably damaging Het
Shkbp1 T C 7: 27,041,949 (GRCm39) N635S probably benign Het
Trpm6 A G 19: 18,869,383 (GRCm39) D1990G possibly damaging Het
Usp48 A G 4: 137,343,129 (GRCm39) N426S probably benign Het
Vmn2r16 G A 5: 109,511,613 (GRCm39) V607M possibly damaging Het
Zfp110 C T 7: 12,582,672 (GRCm39) T440I possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACTGAGCTGGGAAAATGAG -3'
(R):5'- CCTGGGCTCTGTATCTTCAG -3'

Sequencing Primer
(F):5'- GGATGCTGGTAATGGACATACCC -3'
(R):5'- CAGTTTCAAAGCTTGAGTGGATTCAG -3'
Posted On 2017-03-31