Incidental Mutation 'R5956:Gbx2'
ID471157
Institutional Source Beutler Lab
Gene Symbol Gbx2
Ensembl Gene ENSMUSG00000034486
Gene Namegastrulation brain homeobox 2
SynonymsGbx-2, Stra7, MMoxA
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5956 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location89927956-89931179 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 89933186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036954]
Predicted Effect probably benign
Transcript: ENSMUST00000036954
SMART Domains Protein: ENSMUSP00000048508
Gene: ENSMUSG00000034486

DomainStartEndE-ValueType
low complexity region 56 82 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
HOX 247 309 7.58e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189763
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with vascular, neurological, skeletal, and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acad9 A G 3: 36,075,174 probably benign Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx31 A T 2: 28,874,173 I464F probably damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Exoc2 C A 13: 30,820,623 C859F probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Gm1966 T C 7: 106,601,470 noncoding transcript Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1012 A G 2: 85,753,839 probably benign Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Trrap C T 5: 144,807,391 silent Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Gbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Gbx2 APN 1 89928837 missense probably damaging 1.00
IGL01804:Gbx2 APN 1 89928981 missense probably benign 0.00
IGL02345:Gbx2 APN 1 89928976 missense probably benign 0.00
IGL02370:Gbx2 APN 1 89929149 splice site probably benign
IGL02957:Gbx2 APN 1 89930653 missense probably benign 0.02
IGL02959:Gbx2 APN 1 89928795 missense probably damaging 1.00
R2280:Gbx2 UTSW 1 89930637 missense probably damaging 1.00
R2405:Gbx2 UTSW 1 89930908 start gained probably benign
R2860:Gbx2 UTSW 1 89929131 missense probably damaging 0.97
R2861:Gbx2 UTSW 1 89929131 missense probably damaging 0.97
R5384:Gbx2 UTSW 1 89928913 missense probably damaging 1.00
R5587:Gbx2 UTSW 1 89933122 unclassified probably benign
R5747:Gbx2 UTSW 1 89928715 missense probably damaging 0.98
R6053:Gbx2 UTSW 1 89930437 missense probably benign 0.00
R6633:Gbx2 UTSW 1 89928720 frame shift probably null
R7479:Gbx2 UTSW 1 89930651 missense probably benign 0.02
R7505:Gbx2 UTSW 1 89928733 missense probably benign 0.26
R7768:Gbx2 UTSW 1 89928984 missense probably benign 0.09
R8184:Gbx2 UTSW 1 89928828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGGGATACACGGGAAGG -3'
(R):5'- AAAATAGCCAAAGGGATCCTTGTC -3'

Sequencing Primer
(F):5'- GGATACCCAAGCTCTAGTCCCTG -3'
(R):5'- TGAGTAACTGCTCACCCA -3'
Posted On2017-03-31