Incidental Mutation 'R5956:Gm1966'
ID471189
Institutional Source Beutler Lab
Gene Symbol Gm1966
Ensembl Gene ENSMUSG00000073902
Gene Namepredicted gene 1966
Synonyms
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5956 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106596743-106604035 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 106601470 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184540
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acad9 A G 3: 36,075,174 probably benign Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx31 A T 2: 28,874,173 I464F probably damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Exoc2 C A 13: 30,820,623 C859F probably benign Het
Gbx2 T C 1: 89,933,186 probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1012 A G 2: 85,753,839 probably benign Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Trrap C T 5: 144,807,391 silent Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Gm1966
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Gm1966 APN 7 106602035 missense probably benign 0.10
IGL01410:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01415:Gm1966 APN 7 106603051 exon noncoding transcript
IGL01538:Gm1966 APN 7 106602537 missense probably damaging 0.96
IGL01751:Gm1966 APN 7 106602309 missense possibly damaging 0.80
IGL01916:Gm1966 APN 7 106601826 missense probably benign 0.28
IGL02171:Gm1966 APN 7 106601341 exon noncoding transcript
IGL02550:Gm1966 APN 7 106601639 exon noncoding transcript
H8562:Gm1966 UTSW 7 106603149 missense probably damaging 1.00
R0016:Gm1966 UTSW 7 106603246 missense probably benign 0.00
R0178:Gm1966 UTSW 7 106601821 missense probably damaging 1.00
R0420:Gm1966 UTSW 7 106603883 missense probably damaging 1.00
R0658:Gm1966 UTSW 7 106602886 missense possibly damaging 0.89
R1378:Gm1966 UTSW 7 106602166 missense probably damaging 0.97
R1506:Gm1966 UTSW 7 106601581 missense probably benign 0.08
R1628:Gm1966 UTSW 7 106603269 nonsense probably null
R1834:Gm1966 UTSW 7 106603776 missense possibly damaging 0.79
R1888:Gm1966 UTSW 7 106597423 exon noncoding transcript
R2145:Gm1966 UTSW 7 106603008 missense possibly damaging 0.84
R4056:Gm1966 UTSW 7 106604009 missense possibly damaging 0.59
R4067:Gm1966 UTSW 7 106599565 exon noncoding transcript
R4631:Gm1966 UTSW 7 106599523 exon noncoding transcript
R4817:Gm1966 UTSW 7 106601230 exon noncoding transcript
R4900:Gm1966 UTSW 7 106598586 exon noncoding transcript
R4970:Gm1966 UTSW 7 106600657 exon noncoding transcript
R5009:Gm1966 UTSW 7 106601560 exon noncoding transcript
R5050:Gm1966 UTSW 7 106596972 exon noncoding transcript
R5086:Gm1966 UTSW 7 106598027 exon noncoding transcript
R5090:Gm1966 UTSW 7 106600902 exon noncoding transcript
R5168:Gm1966 UTSW 7 106596847 exon noncoding transcript
R5260:Gm1966 UTSW 7 106599204 exon noncoding transcript
R5331:Gm1966 UTSW 7 106598751 exon noncoding transcript
R5389:Gm1966 UTSW 7 106598235 exon noncoding transcript
R5433:Gm1966 UTSW 7 106600107 exon noncoding transcript
R5488:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5489:Gm1966 UTSW 7 106601590 exon noncoding transcript
R5504:Gm1966 UTSW 7 106602744 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCCAACATCAGTAGCTTTTGTAGG -3'
(R):5'- GGGTCACTGTTGTCTGAAGAAG -3'

Sequencing Primer
(F):5'- GGAAATAGAATGGAAGCTCCTTTTC -3'
(R):5'- GTCTGAAGAAGTTGCACATGTCCTC -3'
Posted On2017-03-31