Mutagenetix > Incidental Mutation

Incidental Mutation 'R5956:Exoc2'

471205

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

044144-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R5956 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30820623 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 859 (C859F)

Ref Sequence

ENSEMBL: ENSMUSP00000100010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: C859F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: C859F

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: C859F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: C859F

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Meta Mutation Damage Score

0.1408

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,157,119	I398K	possibly damaging	Het
A530099J19Rik	T	G	13: 19,729,130		noncoding transcript	Het
Acad9	A	G	3: 36,075,174		probably benign	Het
Acsm2	T	C	7: 119,554,481	S5P	unknown	Het
Akp3	T	C	1: 87,126,945	I334T	probably damaging	Het
Amy1	C	T	3: 113,563,662	R176H	probably benign	Het
Ank2	A	T	3: 126,942,688		probably benign	Het
Cav1	C	A	6: 17,307,919	N23K	probably damaging	Het
Cep126	A	G	9: 8,112,119	V151A	probably benign	Het
Cnot1	A	G	8: 95,754,978		probably null	Het
Crim1	T	A	17: 78,315,717	V448E	probably damaging	Het
Csmd3	T	C	15: 48,791,882	E8G	possibly damaging	Het
Ddx31	A	T	2: 28,874,173	I464F	probably damaging	Het
Ddx54	A	G	5: 120,626,367		probably benign	Het
Dhx16	A	G	17: 35,882,870	E319G	probably damaging	Het
Efl1	A	G	7: 82,651,899	D37G	probably damaging	Het
Epha5	T	C	5: 84,150,369	R444G	probably damaging	Het
Gbx2	T	C	1: 89,933,186		probably benign	Het
Gm12258	G	A	11: 58,859,459	A9T	probably benign	Het
Gm1966	T	C	7: 106,601,470		noncoding transcript	Het
Grm4	A	G	17: 27,435,155	V607A	probably benign	Het
Ighv1-74	C	A	12: 115,802,835	W55L	probably damaging	Het
Irx4	C	A	13: 73,267,507	Y138*	probably null	Het
Itpr1	C	A	6: 108,506,027	T2352K	probably benign	Het
Kcnk3	T	G	5: 30,588,510	V65G	probably damaging	Het
Mctp2	T	C	7: 72,259,175	E130G	probably benign	Het
Mgat5	C	A	1: 127,382,939	R197S	probably benign	Het
Mpg	T	C	11: 32,227,951		probably null	Het
Muc5b	T	C	7: 141,864,173	C3619R	probably damaging	Het
Myo15b	G	A	11: 115,873,757	V1321I	probably benign	Het
Myo1b	T	C	1: 51,776,232	T658A	probably damaging	Het
Nomo1	T	C	7: 46,042,613	S154P	possibly damaging	Het
Nsd1	T	A	13: 55,263,404	F1423I	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1012	A	G	2: 85,753,839		probably benign	Het
Osbpl6	A	G	2: 76,549,512	R149G	probably damaging	Het
Papola	T	A	12: 105,811,041	W281R	probably damaging	Het
Pole	C	T	5: 110,337,287		probably benign	Het
Rptn	A	G	3: 93,398,027	N889S	possibly damaging	Het
Scn10a	A	G	9: 119,631,560	S1084P	probably damaging	Het
Scnm1	T	C	3: 95,130,285	I157V	probably benign	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Siglece	T	C	7: 43,659,336	T198A	probably damaging	Het
Sptb	T	A	12: 76,604,168	M1678L	probably benign	Het
Taf8	A	T	17: 47,498,542	M98K	probably damaging	Het
Tead2	T	A	7: 45,220,714		probably benign	Het
Tmem206	A	G	1: 191,348,371	S263G	probably damaging	Het
Trrap	C	T	5: 144,807,391		silent	Het
Ttn	G	T	2: 76,945,570	N1709K	probably damaging	Het
Ube3a	T	C	7: 59,277,020		probably benign	Het
Ube3c	T	C	5: 29,599,056		probably benign	Het
Unc80	T	C	1: 66,527,964	S910P	probably damaging	Het
Usp30	G	A	5: 114,119,621	R280Q	possibly damaging	Het
Vsx1	T	C	2: 150,688,537	S142G	possibly damaging	Het
Wdr95	T	G	5: 149,594,482	C360G	probably benign	Het
Zbtb4	A	G	11: 69,778,214	I588V	probably benign	Het
Zdhhc4	A	T	5: 143,324,849		probably benign	Het
Zfp568	C	A	7: 29,997,863	N69K	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGAGAGTCACTGTCTTACAATAGGC -3'
(R):5'- ACTCACACTTGACAGCAGCG -3'

Sequencing Primer
(F):5'- GTCACTGTCTTACAATAGGCTTGAGC -3'
(R):5'- CACTTGACAGCAGCGTTAAAG -3'

Posted On

2017-03-31