Incidental Mutation 'R5956:Exoc2'
ID 471205
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission 044144-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R5956 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 30820623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 859 (C859F)
Ref Sequence ENSEMBL: ENSMUSP00000100010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: C859F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: C859F

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: C859F

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: C859F

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Meta Mutation Damage Score 0.1408 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,157,119 I398K possibly damaging Het
A530099J19Rik T G 13: 19,729,130 noncoding transcript Het
Acad9 A G 3: 36,075,174 probably benign Het
Acsm2 T C 7: 119,554,481 S5P unknown Het
Akp3 T C 1: 87,126,945 I334T probably damaging Het
Amy1 C T 3: 113,563,662 R176H probably benign Het
Ank2 A T 3: 126,942,688 probably benign Het
Cav1 C A 6: 17,307,919 N23K probably damaging Het
Cep126 A G 9: 8,112,119 V151A probably benign Het
Cnot1 A G 8: 95,754,978 probably null Het
Crim1 T A 17: 78,315,717 V448E probably damaging Het
Csmd3 T C 15: 48,791,882 E8G possibly damaging Het
Ddx31 A T 2: 28,874,173 I464F probably damaging Het
Ddx54 A G 5: 120,626,367 probably benign Het
Dhx16 A G 17: 35,882,870 E319G probably damaging Het
Efl1 A G 7: 82,651,899 D37G probably damaging Het
Epha5 T C 5: 84,150,369 R444G probably damaging Het
Gbx2 T C 1: 89,933,186 probably benign Het
Gm12258 G A 11: 58,859,459 A9T probably benign Het
Gm1966 T C 7: 106,601,470 noncoding transcript Het
Grm4 A G 17: 27,435,155 V607A probably benign Het
Ighv1-74 C A 12: 115,802,835 W55L probably damaging Het
Irx4 C A 13: 73,267,507 Y138* probably null Het
Itpr1 C A 6: 108,506,027 T2352K probably benign Het
Kcnk3 T G 5: 30,588,510 V65G probably damaging Het
Mctp2 T C 7: 72,259,175 E130G probably benign Het
Mgat5 C A 1: 127,382,939 R197S probably benign Het
Mpg T C 11: 32,227,951 probably null Het
Muc5b T C 7: 141,864,173 C3619R probably damaging Het
Myo15b G A 11: 115,873,757 V1321I probably benign Het
Myo1b T C 1: 51,776,232 T658A probably damaging Het
Nomo1 T C 7: 46,042,613 S154P possibly damaging Het
Nsd1 T A 13: 55,263,404 F1423I probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1012 A G 2: 85,753,839 probably benign Het
Osbpl6 A G 2: 76,549,512 R149G probably damaging Het
Papola T A 12: 105,811,041 W281R probably damaging Het
Pole C T 5: 110,337,287 probably benign Het
Rptn A G 3: 93,398,027 N889S possibly damaging Het
Scn10a A G 9: 119,631,560 S1084P probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Siglece T C 7: 43,659,336 T198A probably damaging Het
Sptb T A 12: 76,604,168 M1678L probably benign Het
Taf8 A T 17: 47,498,542 M98K probably damaging Het
Tead2 T A 7: 45,220,714 probably benign Het
Tmem206 A G 1: 191,348,371 S263G probably damaging Het
Trrap C T 5: 144,807,391 silent Het
Ttn G T 2: 76,945,570 N1709K probably damaging Het
Ube3a T C 7: 59,277,020 probably benign Het
Ube3c T C 5: 29,599,056 probably benign Het
Unc80 T C 1: 66,527,964 S910P probably damaging Het
Usp30 G A 5: 114,119,621 R280Q possibly damaging Het
Vsx1 T C 2: 150,688,537 S142G possibly damaging Het
Wdr95 T G 5: 149,594,482 C360G probably benign Het
Zbtb4 A G 11: 69,778,214 I588V probably benign Het
Zdhhc4 A T 5: 143,324,849 probably benign Het
Zfp568 C A 7: 29,997,863 N69K probably damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGAGTCACTGTCTTACAATAGGC -3'
(R):5'- ACTCACACTTGACAGCAGCG -3'

Sequencing Primer
(F):5'- GTCACTGTCTTACAATAGGCTTGAGC -3'
(R):5'- CACTTGACAGCAGCGTTAAAG -3'
Posted On 2017-03-31