Mutagenetix > Incidental Mutation

Incidental Mutation 'R5956:Crim1'

471211

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

044144-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5956 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78315717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 448 (V448E)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

probably damaging
Transcript: ENSMUST00000112498
AA Change: V448E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: V448E

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.1728

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,157,119	I398K	possibly damaging	Het
A530099J19Rik	T	G	13: 19,729,130		noncoding transcript	Het
Acad9	A	G	3: 36,075,174		probably benign	Het
Acsm2	T	C	7: 119,554,481	S5P	unknown	Het
Akp3	T	C	1: 87,126,945	I334T	probably damaging	Het
Amy1	C	T	3: 113,563,662	R176H	probably benign	Het
Ank2	A	T	3: 126,942,688		probably benign	Het
Cav1	C	A	6: 17,307,919	N23K	probably damaging	Het
Cep126	A	G	9: 8,112,119	V151A	probably benign	Het
Cnot1	A	G	8: 95,754,978		probably null	Het
Csmd3	T	C	15: 48,791,882	E8G	possibly damaging	Het
Ddx31	A	T	2: 28,874,173	I464F	probably damaging	Het
Ddx54	A	G	5: 120,626,367		probably benign	Het
Dhx16	A	G	17: 35,882,870	E319G	probably damaging	Het
Efl1	A	G	7: 82,651,899	D37G	probably damaging	Het
Epha5	T	C	5: 84,150,369	R444G	probably damaging	Het
Exoc2	C	A	13: 30,820,623	C859F	probably benign	Het
Gbx2	T	C	1: 89,933,186		probably benign	Het
Gm12258	G	A	11: 58,859,459	A9T	probably benign	Het
Gm1966	T	C	7: 106,601,470		noncoding transcript	Het
Grm4	A	G	17: 27,435,155	V607A	probably benign	Het
Ighv1-74	C	A	12: 115,802,835	W55L	probably damaging	Het
Irx4	C	A	13: 73,267,507	Y138*	probably null	Het
Itpr1	C	A	6: 108,506,027	T2352K	probably benign	Het
Kcnk3	T	G	5: 30,588,510	V65G	probably damaging	Het
Mctp2	T	C	7: 72,259,175	E130G	probably benign	Het
Mgat5	C	A	1: 127,382,939	R197S	probably benign	Het
Mpg	T	C	11: 32,227,951		probably null	Het
Muc5b	T	C	7: 141,864,173	C3619R	probably damaging	Het
Myo15b	G	A	11: 115,873,757	V1321I	probably benign	Het
Myo1b	T	C	1: 51,776,232	T658A	probably damaging	Het
Nomo1	T	C	7: 46,042,613	S154P	possibly damaging	Het
Nsd1	T	A	13: 55,263,404	F1423I	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1012	A	G	2: 85,753,839		probably benign	Het
Osbpl6	A	G	2: 76,549,512	R149G	probably damaging	Het
Papola	T	A	12: 105,811,041	W281R	probably damaging	Het
Pole	C	T	5: 110,337,287		probably benign	Het
Rptn	A	G	3: 93,398,027	N889S	possibly damaging	Het
Scn10a	A	G	9: 119,631,560	S1084P	probably damaging	Het
Scnm1	T	C	3: 95,130,285	I157V	probably benign	Het
Sertad2	G	A	11: 20,647,884	G27S	probably benign	Het
Siglece	T	C	7: 43,659,336	T198A	probably damaging	Het
Sptb	T	A	12: 76,604,168	M1678L	probably benign	Het
Taf8	A	T	17: 47,498,542	M98K	probably damaging	Het
Tead2	T	A	7: 45,220,714		probably benign	Het
Tmem206	A	G	1: 191,348,371	S263G	probably damaging	Het
Trrap	C	T	5: 144,807,391		silent	Het
Ttn	G	T	2: 76,945,570	N1709K	probably damaging	Het
Ube3a	T	C	7: 59,277,020		probably benign	Het
Ube3c	T	C	5: 29,599,056		probably benign	Het
Unc80	T	C	1: 66,527,964	S910P	probably damaging	Het
Usp30	G	A	5: 114,119,621	R280Q	possibly damaging	Het
Vsx1	T	C	2: 150,688,537	S142G	possibly damaging	Het
Wdr95	T	G	5: 149,594,482	C360G	probably benign	Het
Zbtb4	A	G	11: 69,778,214	I588V	probably benign	Het
Zdhhc4	A	T	5: 143,324,849		probably benign	Het
Zfp568	C	A	7: 29,997,863	N69K	probably damaging	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9702:Crim1	UTSW	17	78374087	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- AGGTCAGATTCGCAAGGCTTC -3'
(R):5'- TGGGCTGCATAATAAATTTGCCTG -3'

Sequencing Primer
(F):5'- GTCAGATTCGCAAGGCTTCATACC -3'
(R):5'- ATTTGCCTGCAACTGGTAACG -3'

Posted On

2017-03-31