Mutagenetix > Incidental Mutation

Incidental Mutation 'R5957:Iqca'

471212

Institutional Source

Beutler Lab

Gene Symbol

Iqca

Ensembl Gene

ENSMUSG00000026301

Gene Name

IQ motif containing with AAA domain

Synonyms

MMRRC Submission

043246-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5957 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90042132-90153401 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90080948 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 450 (D450V)

Ref Sequence

ENSEMBL: ENSMUSP00000148643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000212394]

AlphaFold

Q9CUL5

Predicted Effect

probably damaging
Transcript: ENSMUST00000113094
AA Change: D441V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: D441V

Domain	Start	End	E-Value	Type
IQ	205	227	6.97e0	SMART
coiled coil region	340	380	N/A	INTRINSIC
coiled coil region	425	450	N/A	INTRINSIC
low complexity region	464	487	N/A	INTRINSIC
AAA	567	706	1.08e-3	SMART
low complexity region	812	829	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186403

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189690

Predicted Effect

probably damaging
Transcript: ENSMUST00000212394
AA Change: D450V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,161	T1704A	probably benign	Het
Adgrg7	T	A	16: 56,773,427	N142I	probably damaging	Het
Aldh18a1	A	T	19: 40,570,537	Y286*	probably null	Het
Armc4	T	C	18: 7,285,706	E219G	probably benign	Het
Arpp21	T	C	9: 112,185,686	T17A	probably benign	Het
Atp5s	T	C	12: 69,743,784	V185A	probably benign	Het
Bnip2	T	C	9: 69,999,238	I147T	probably damaging	Het
Ccr8	T	C	9: 120,093,827	Y3H	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Cul7	G	A	17: 46,657,757	G553S	probably damaging	Het
Cyp21a1	A	G	17: 34,803,176	I206T	probably benign	Het
Dennd4b	A	G	3: 90,270,965	D488G	probably damaging	Het
Dip2b	T	C	15: 100,209,694	L1195P	probably benign	Het
Dock5	T	A	14: 67,857,994	H77L	probably benign	Het
Fbxw13	C	T	9: 109,192,666		probably null	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Gbf1	G	T	19: 46,246,221		probably null	Het
Gm12794	T	C	4: 101,941,701	F290L	probably benign	Het
Gm4846	T	C	1: 166,486,953	I374V	probably benign	Het
Gsk3b	C	A	16: 38,193,953	P258T	probably damaging	Het
Igsf5	T	C	16: 96,364,049	V8A	probably benign	Het
Il22	T	A	10: 118,205,166	L59Q	probably damaging	Het
Ildr1	T	C	16: 36,725,534	*517Q	probably null	Het
Itga5	T	C	15: 103,351,429	D647G	probably benign	Het
Myh7	T	G	14: 54,989,078	N408T	probably damaging	Het
Mylk3	T	C	8: 85,328,637	M564V	probably damaging	Het
Nsd2	T	A	5: 33,855,603	M407K	probably damaging	Het
Oprd1	C	T	4: 132,144,163	V75I	probably benign	Het
Poli	G	A	18: 70,517,440	H310Y	probably benign	Het
Ptch1	C	T	13: 63,525,115	R755H	probably damaging	Het
Pygl	A	T	12: 70,199,720	M351K	probably damaging	Het
Serpinb9b	T	C	13: 33,039,848	L341P	possibly damaging	Het
Slc47a1	A	G	11: 61,344,342	V555A	probably benign	Het
Slc8a2	C	A	7: 16,145,284	T565K	possibly damaging	Het
Snx14	T	C	9: 88,403,274	I446V	possibly damaging	Het
Syde1	T	C	10: 78,590,117	Y72C	probably damaging	Het
Trim37	C	T	11: 87,145,551	R138C	probably damaging	Het
Tubgcp5	T	A	7: 55,814,962	S530R	probably benign	Het
Vps13c	T	C	9: 67,954,971	S2957P	probably damaging	Het
Wdr41	T	C	13: 94,997,187		probably null	Het
Zyg11b	T	C	4: 108,245,013	K504E	probably damaging	Het

Other mutations in Iqca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Iqca	APN	1	90045657	missense	probably benign	0.10
IGL01367:Iqca	APN	1	90070628	splice site	probably benign
IGL01545:Iqca	APN	1	90045642	missense	probably benign
IGL01797:Iqca	APN	1	90144819	critical splice donor site	probably null
IGL02098:Iqca	APN	1	90047941	missense	probably damaging	0.96
IGL02194:Iqca	APN	1	90045663	missense	probably benign	0.16
IGL03230:Iqca	APN	1	90145002	missense	probably damaging	1.00
IGL03259:Iqca	APN	1	90052434	missense	probably damaging	1.00
IGL03372:Iqca	APN	1	90144969	missense	possibly damaging	0.80
R0383:Iqca	UTSW	1	90142707	missense	probably damaging	1.00
R0610:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0685:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0798:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0799:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0800:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0801:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0825:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0826:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0827:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0862:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0863:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0864:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0960:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0961:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0962:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0963:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1101:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1344:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1523:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1646:Iqca	UTSW	1	90140038	missense	probably damaging	0.98
R1682:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1742:Iqca	UTSW	1	90098051	missense	probably benign	0.01
R1774:Iqca	UTSW	1	90080903	missense	probably benign	0.02
R1775:Iqca	UTSW	1	90081416	missense	probably damaging	1.00
R2011:Iqca	UTSW	1	90045626	missense	probably benign	0.00
R2065:Iqca	UTSW	1	90130231	missense	probably benign	0.01
R2156:Iqca	UTSW	1	90089516	missense	possibly damaging	0.78
R2186:Iqca	UTSW	1	90081344	missense	probably benign	0.06
R3872:Iqca	UTSW	1	90089481	missense	probably damaging	1.00
R4308:Iqca	UTSW	1	90144897	missense	probably damaging	1.00
R4578:Iqca	UTSW	1	90073750	missense	probably damaging	0.98
R4737:Iqca	UTSW	1	90077822	missense	probably damaging	0.99
R4867:Iqca	UTSW	1	90089504	missense	probably benign	0.00
R4884:Iqca	UTSW	1	90140037	missense	probably benign	0.10
R4887:Iqca	UTSW	1	90045701	missense	probably damaging	1.00
R5352:Iqca	UTSW	1	90130196	missense	probably benign	0.00
R5733:Iqca	UTSW	1	90070535	missense	probably damaging	0.97
R5838:Iqca	UTSW	1	90144945	missense	probably benign	0.22
R5951:Iqca	UTSW	1	90140097	splice site	probably null
R6696:Iqca	UTSW	1	90130200	missense	probably benign
R7240:Iqca	UTSW	1	90070550	missense	possibly damaging	0.88
R7769:Iqca	UTSW	1	90077810	missense	possibly damaging	0.82
R7841:Iqca	UTSW	1	90059615	missense
R8069:Iqca	UTSW	1	90045744	missense	probably damaging	0.96
R8103:Iqca	UTSW	1	90059608	missense
R8932:Iqca	UTSW	1	90140028	missense	probably damaging	1.00
R8963:Iqca	UTSW	1	90139927	missense	probably benign	0.02
R9055:Iqca	UTSW	1	90070613	missense	probably benign	0.02
R9168:Iqca	UTSW	1	90138215	missense	probably damaging	0.98
R9342:Iqca	UTSW	1	90144966	missense	probably damaging	0.99
R9647:Iqca	UTSW	1	90070536	missense	probably benign	0.15
Z1176:Iqca	UTSW	1	90045725	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- CACCACACTTGATGCAAGGC -3'
(R):5'- TCACCTCCAGTAAGGGGATG -3'

Sequencing Primer
(F):5'- CTTGATGCAAGGCACAACC -3'
(R):5'- TTATTACACTCACCTCCAGTAAGGGG -3'

Posted On

2017-03-31