Incidental Mutation 'R5957:Gm12794'
ID471216
Institutional Source Beutler Lab
Gene Symbol Gm12794
Ensembl Gene ENSMUSG00000070890
Gene Namepredicted gene 12794
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location101940407-101943183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101941701 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 290 (F290L)
Ref Sequence ENSEMBL: ENSMUSP00000051550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052027]
Predicted Effect probably benign
Transcript: ENSMUST00000052027
AA Change: F290L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000051550
Gene: ENSMUSG00000070890
AA Change: F290L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 257 409 9e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Gm12794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Gm12794 APN 4 101941701 missense probably benign 0.02
IGL01360:Gm12794 APN 4 101940468 missense possibly damaging 0.94
IGL01837:Gm12794 APN 4 101941453 missense probably damaging 1.00
IGL01870:Gm12794 APN 4 101940690 missense probably benign 0.03
IGL02040:Gm12794 APN 4 101941134 missense possibly damaging 0.94
IGL03264:Gm12794 APN 4 101941132 missense probably damaging 0.99
R0033:Gm12794 UTSW 4 101941684 missense probably benign
R0334:Gm12794 UTSW 4 101941584 missense probably benign 0.01
R0846:Gm12794 UTSW 4 101941250 missense probably benign 0.00
R1464:Gm12794 UTSW 4 101941306 missense probably damaging 0.97
R1464:Gm12794 UTSW 4 101941306 missense probably damaging 0.97
R1774:Gm12794 UTSW 4 101940458 missense probably benign 0.27
R1888:Gm12794 UTSW 4 101941138 missense probably damaging 0.99
R1888:Gm12794 UTSW 4 101941138 missense probably damaging 0.99
R4510:Gm12794 UTSW 4 101941560 missense probably benign 0.00
R4511:Gm12794 UTSW 4 101941560 missense probably benign 0.00
R4890:Gm12794 UTSW 4 101941591 missense probably damaging 0.99
R4960:Gm12794 UTSW 4 101941464 missense probably benign
R5043:Gm12794 UTSW 4 101940524 missense possibly damaging 0.89
R5297:Gm12794 UTSW 4 101941151 missense possibly damaging 0.46
R5780:Gm12794 UTSW 4 101941527 missense probably damaging 1.00
R6409:Gm12794 UTSW 4 101940677 nonsense probably null
R6452:Gm12794 UTSW 4 101941443 missense probably benign 0.02
R7619:Gm12794 UTSW 4 101941300 missense probably benign 0.01
R8460:Gm12794 UTSW 4 101941227 missense probably benign 0.00
Z1177:Gm12794 UTSW 4 101941125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTTGGCCAGATGAGAAATC -3'
(R):5'- ATATCCCCTACCCCAGTTCAGG -3'

Sequencing Primer
(F):5'- AGAGGTGCTGCCAAATTC -3'
(R):5'- CCCAGTTCAGGCTCTATTAAAAGAG -3'
Posted On2017-03-31