Incidental Mutation 'R5957:Zyg11b'
ID471217
Institutional Source Beutler Lab
Gene Symbol Zyg11b
Ensembl Gene ENSMUSG00000034636
Gene Namezyg-ll family member B, cell cycle regulator
Synonyms1110046I03Rik, LOC242610, 2810482G21Rik, D4Mgi23
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108229724-108301096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108245013 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 504 (K504E)
Ref Sequence ENSEMBL: ENSMUSP00000043844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043616]
Predicted Effect probably damaging
Transcript: ENSMUST00000043616
AA Change: K504E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043844
Gene: ENSMUSG00000034636
AA Change: K504E

DomainStartEndE-ValueType
SCOP:d1jdha_ 370 722 3e-16 SMART
Blast:ARM 480 526 1e-17 BLAST
Blast:ARM 528 570 3e-19 BLAST
Blast:ARM 638 679 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130508
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Other mutations in Zyg11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Zyg11b APN 4 108237416 missense probably damaging 1.00
IGL01143:Zyg11b APN 4 108244994 missense possibly damaging 0.69
IGL01627:Zyg11b APN 4 108250788 missense probably benign 0.19
IGL02517:Zyg11b APN 4 108266318 missense probably damaging 0.96
IGL03166:Zyg11b APN 4 108265889 missense probably benign 0.32
arch UTSW 4 108237380 nonsense probably null
R0326:Zyg11b UTSW 4 108272253 missense possibly damaging 0.77
R0345:Zyg11b UTSW 4 108266407 missense probably damaging 1.00
R0396:Zyg11b UTSW 4 108255308 missense probably damaging 1.00
R0571:Zyg11b UTSW 4 108260042 missense probably damaging 1.00
R0718:Zyg11b UTSW 4 108242076 missense possibly damaging 0.94
R1426:Zyg11b UTSW 4 108250812 missense probably damaging 1.00
R1495:Zyg11b UTSW 4 108266213 missense probably damaging 1.00
R1829:Zyg11b UTSW 4 108266093 missense possibly damaging 0.65
R1907:Zyg11b UTSW 4 108255226 missense probably damaging 1.00
R1916:Zyg11b UTSW 4 108272283 missense probably damaging 0.99
R1980:Zyg11b UTSW 4 108265930 missense probably damaging 0.99
R2070:Zyg11b UTSW 4 108250819 missense possibly damaging 0.73
R2495:Zyg11b UTSW 4 108244724 critical splice donor site probably null
R4717:Zyg11b UTSW 4 108241872 missense probably damaging 0.99
R5889:Zyg11b UTSW 4 108237380 nonsense probably null
R6606:Zyg11b UTSW 4 108236089 missense probably benign 0.00
R7151:Zyg11b UTSW 4 108244922 missense possibly damaging 0.49
R7316:Zyg11b UTSW 4 108250502 missense possibly damaging 0.81
R7488:Zyg11b UTSW 4 108266458 missense possibly damaging 0.65
X0022:Zyg11b UTSW 4 108236101 missense probably benign
X0067:Zyg11b UTSW 4 108255346 missense probably benign
Z1177:Zyg11b UTSW 4 108255364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAACTGTGCAACTGTTAGG -3'
(R):5'- GTCCTGTAAATTGTTGTCAGACC -3'

Sequencing Primer
(F):5'- CTGTGCAACTGTTAGGTAAATTTCC -3'
(R):5'- AATTGTTGTCAGACCTCTACACAC -3'
Posted On2017-03-31