Incidental Mutation 'R5957:Oprd1'
ID471218
Institutional Source Beutler Lab
Gene Symbol Oprd1
Ensembl Gene ENSMUSG00000050511
Gene Nameopioid receptor, delta 1
SynonymsDOR, mDOR, Nbor, DOR-1
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5957 (G1)
Quality Score167
Status Not validated
Chromosome4
Chromosomal Location132110726-132144486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132144163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 75 (V75I)
Ref Sequence ENSEMBL: ENSMUSP00000050077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056336]
PDB Structure
Structure of the delta opioid receptor bound to naltrindole [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000056336
AA Change: V75I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000050077
Gene: ENSMUSG00000050511
AA Change: V75I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 58 288 8.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 60 333 1.7e-11 PFAM
Pfam:7tm_1 66 318 4e-58 PFAM
Pfam:7TM_GPCR_Srv 69 335 3.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117559
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele do not develop analgesic tolerance to morphine while mice homozygous for a different knock-out allele exhibit hyperactivity, increased anxiety, and decreased coping response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Oprd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02825:Oprd1 APN 4 132117359 missense probably damaging 0.96
IGL03030:Oprd1 APN 4 132117385 missense possibly damaging 0.94
R0066:Oprd1 UTSW 4 132113988 missense probably benign 0.00
R0403:Oprd1 UTSW 4 132113768 missense probably benign 0.18
R1857:Oprd1 UTSW 4 132113681 missense probably damaging 1.00
R4808:Oprd1 UTSW 4 132117394 missense probably damaging 1.00
R5176:Oprd1 UTSW 4 132113793 missense probably benign 0.34
R5693:Oprd1 UTSW 4 132144410 start gained probably benign
R6264:Oprd1 UTSW 4 132114054 missense possibly damaging 0.78
R6896:Oprd1 UTSW 4 132117301 missense probably damaging 0.97
R7205:Oprd1 UTSW 4 132113801 missense probably damaging 1.00
R7417:Oprd1 UTSW 4 132117452 missense probably damaging 1.00
R7426:Oprd1 UTSW 4 132114067 missense probably benign 0.02
R7480:Oprd1 UTSW 4 132117181 missense possibly damaging 0.92
R7552:Oprd1 UTSW 4 132113781 missense possibly damaging 0.80
Z1177:Oprd1 UTSW 4 132113729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTCCATGATGCAGAAGC -3'
(R):5'- CTCGTCAACCTCTCGGACG -3'

Sequencing Primer
(F):5'- TATGTAGTTAGGCTAGTGCAAGCAC -3'
(R):5'- TCGGACGCCTTTCCCAG -3'
Posted On2017-03-31