Mutagenetix > Incidental Mutation

Incidental Mutation 'R5957:Slc8a2'

471222

Institutional Source

Beutler Lab

Gene Symbol

Slc8a2

Ensembl Gene

ENSMUSG00000030376

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 2

Synonyms

Ncx2

MMRRC Submission

043246-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R5957 (G1)

Quality Score

156

Status

Not validated

Chromosome

Chromosomal Location

16129826-16161063 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 16145284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 565 (T565K)

Ref Sequence

ENSEMBL: ENSMUSP00000147497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]

AlphaFold

Q8K596

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168693
AA Change: T565K

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: T565K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	74	245	8.6e-35	PFAM
Pfam:Na_Ca_ex_C	248	378	7.8e-50	PFAM
Calx_beta	383	483	3.27e-47	SMART
Calx_beta	512	612	3.37e-49	SMART
low complexity region	704	717	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	2.5e-27	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211649
AA Change: T565K

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,161	T1704A	probably benign	Het
Adgrg7	T	A	16: 56,773,427	N142I	probably damaging	Het
Aldh18a1	A	T	19: 40,570,537	Y286*	probably null	Het
Armc4	T	C	18: 7,285,706	E219G	probably benign	Het
Arpp21	T	C	9: 112,185,686	T17A	probably benign	Het
Atp5s	T	C	12: 69,743,784	V185A	probably benign	Het
Bnip2	T	C	9: 69,999,238	I147T	probably damaging	Het
Ccr8	T	C	9: 120,093,827	Y3H	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Cul7	G	A	17: 46,657,757	G553S	probably damaging	Het
Cyp21a1	A	G	17: 34,803,176	I206T	probably benign	Het
Dennd4b	A	G	3: 90,270,965	D488G	probably damaging	Het
Dip2b	T	C	15: 100,209,694	L1195P	probably benign	Het
Dock5	T	A	14: 67,857,994	H77L	probably benign	Het
Fbxw13	C	T	9: 109,192,666		probably null	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Gbf1	G	T	19: 46,246,221		probably null	Het
Gm12794	T	C	4: 101,941,701	F290L	probably benign	Het
Gm4846	T	C	1: 166,486,953	I374V	probably benign	Het
Gsk3b	C	A	16: 38,193,953	P258T	probably damaging	Het
Igsf5	T	C	16: 96,364,049	V8A	probably benign	Het
Il22	T	A	10: 118,205,166	L59Q	probably damaging	Het
Ildr1	T	C	16: 36,725,534	*517Q	probably null	Het
Iqca	T	A	1: 90,080,948	D450V	probably damaging	Het
Itga5	T	C	15: 103,351,429	D647G	probably benign	Het
Myh7	T	G	14: 54,989,078	N408T	probably damaging	Het
Mylk3	T	C	8: 85,328,637	M564V	probably damaging	Het
Nsd2	T	A	5: 33,855,603	M407K	probably damaging	Het
Oprd1	C	T	4: 132,144,163	V75I	probably benign	Het
Poli	G	A	18: 70,517,440	H310Y	probably benign	Het
Ptch1	C	T	13: 63,525,115	R755H	probably damaging	Het
Pygl	A	T	12: 70,199,720	M351K	probably damaging	Het
Serpinb9b	T	C	13: 33,039,848	L341P	possibly damaging	Het
Slc47a1	A	G	11: 61,344,342	V555A	probably benign	Het
Snx14	T	C	9: 88,403,274	I446V	possibly damaging	Het
Syde1	T	C	10: 78,590,117	Y72C	probably damaging	Het
Trim37	C	T	11: 87,145,551	R138C	probably damaging	Het
Tubgcp5	T	A	7: 55,814,962	S530R	probably benign	Het
Vps13c	T	C	9: 67,954,971	S2957P	probably damaging	Het
Wdr41	T	C	13: 94,997,187		probably null	Het
Zyg11b	T	C	4: 108,245,013	K504E	probably damaging	Het

Other mutations in Slc8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01778:Slc8a2	APN	7	16158893	missense	probably damaging	1.00
IGL02097:Slc8a2	APN	7	16157156	missense	possibly damaging	0.88
IGL02744:Slc8a2	APN	7	16145029	missense	possibly damaging	0.91
PIT4402001:Slc8a2	UTSW	7	16134494	missense	probably damaging	1.00
PIT4515001:Slc8a2	UTSW	7	16140579	missense	possibly damaging	0.69
R0281:Slc8a2	UTSW	7	16140989	missense	probably benign
R0513:Slc8a2	UTSW	7	16157339	missense	probably damaging	1.00
R0811:Slc8a2	UTSW	7	16141114	missense	probably damaging	1.00
R0812:Slc8a2	UTSW	7	16141114	missense	probably damaging	1.00
R0940:Slc8a2	UTSW	7	16144962	missense	probably benign	0.04
R1167:Slc8a2	UTSW	7	16157387	missense	possibly damaging	0.58
R1508:Slc8a2	UTSW	7	16140597	missense	probably benign	0.00
R1655:Slc8a2	UTSW	7	16141135	missense	probably damaging	1.00
R1917:Slc8a2	UTSW	7	16152920	missense	probably benign	0.11
R1919:Slc8a2	UTSW	7	16152920	missense	probably benign	0.11
R2051:Slc8a2	UTSW	7	16141015	missense	probably damaging	1.00
R2083:Slc8a2	UTSW	7	16134515	missense	probably damaging	1.00
R2128:Slc8a2	UTSW	7	16140492	splice site	probably null
R2149:Slc8a2	UTSW	7	16159164	missense	probably damaging	1.00
R3437:Slc8a2	UTSW	7	16158885	missense	probably damaging	1.00
R3618:Slc8a2	UTSW	7	16152899	missense	possibly damaging	0.48
R4645:Slc8a2	UTSW	7	16134239	missense	probably damaging	1.00
R4741:Slc8a2	UTSW	7	16134308	missense	probably damaging	1.00
R4936:Slc8a2	UTSW	7	16134175	nonsense	probably null
R5071:Slc8a2	UTSW	7	16150583	missense	possibly damaging	0.84
R5072:Slc8a2	UTSW	7	16150583	missense	possibly damaging	0.84
R5074:Slc8a2	UTSW	7	16150583	missense	possibly damaging	0.84
R5150:Slc8a2	UTSW	7	16145176	missense	possibly damaging	0.74
R5358:Slc8a2	UTSW	7	16157303	missense	probably damaging	1.00
R5839:Slc8a2	UTSW	7	16134487	missense	probably damaging	1.00
R6273:Slc8a2	UTSW	7	16145334	missense	possibly damaging	0.94
R6363:Slc8a2	UTSW	7	16134045	missense	probably benign	0.00
R6881:Slc8a2	UTSW	7	16157357	missense	probably damaging	1.00
R7084:Slc8a2	UTSW	7	16145038	missense	probably benign	0.17
R7211:Slc8a2	UTSW	7	16140613	missense	possibly damaging	0.87
R7227:Slc8a2	UTSW	7	16144981	missense	possibly damaging	0.73
R7278:Slc8a2	UTSW	7	16141152	missense	probably damaging	1.00
R7380:Slc8a2	UTSW	7	16134353	missense	probably damaging	1.00
R8239:Slc8a2	UTSW	7	16145305	missense	probably benign	0.00
R8698:Slc8a2	UTSW	7	16157207	missense	probably damaging	1.00
R8926:Slc8a2	UTSW	7	16134269	missense	probably damaging	1.00
R9249:Slc8a2	UTSW	7	16157231	missense	probably damaging	1.00
R9483:Slc8a2	UTSW	7	16152855	missense	possibly damaging	0.95
R9530:Slc8a2	UTSW	7	16145344	missense	probably null	0.86
R9778:Slc8a2	UTSW	7	16153199	missense	probably damaging	1.00
Z1177:Slc8a2	UTSW	7	16140987	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TTCTTCGTGAGGCTGCTGAAC -3'
(R):5'- GGTCAGCTTTACCCTAACCC -3'

Sequencing Primer
(F):5'- TCAGGGCATGTTCGAGCC -3'
(R):5'- GCTTTACCCTAACCCCACCC -3'

Posted On

2017-03-31