Incidental Mutation 'R5957:Bnip2'
ID471227
Institutional Source Beutler Lab
Gene Symbol Bnip2
Ensembl Gene ENSMUSG00000011958
Gene NameBCL2/adenovirus E1B interacting protein 2
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location69989466-70008317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69999238 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 147 (I147T)
Ref Sequence ENSEMBL: ENSMUSP00000133200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034754] [ENSMUST00000085393] [ENSMUST00000117450] [ENSMUST00000154772] [ENSMUST00000165389]
Predicted Effect probably damaging
Transcript: ENSMUST00000034754
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034754
Gene: ENSMUSG00000011958
AA Change: I147T

DomainStartEndE-ValueType
SEC14 150 301 3.23e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085393
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082513
Gene: ENSMUSG00000011958
AA Change: I147T

DomainStartEndE-ValueType
SEC14 150 301 5.62e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117450
AA Change: I147T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113466
Gene: ENSMUSG00000011958
AA Change: I147T

DomainStartEndE-ValueType
SEC14 150 301 1.19e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133307
Predicted Effect probably benign
Transcript: ENSMUST00000137472
SMART Domains Protein: ENSMUSP00000115106
Gene: ENSMUSG00000011958

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 1 67 4.1e-17 PFAM
Pfam:CRAL_TRIO 2 58 4.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143049
Predicted Effect probably benign
Transcript: ENSMUST00000154772
Predicted Effect probably damaging
Transcript: ENSMUST00000165389
AA Change: I147T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133200
Gene: ENSMUSG00000011958
AA Change: I147T

DomainStartEndE-ValueType
SEC14 150 301 5.62e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Bnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Bnip2 APN 9 70002116 splice site probably benign
IGL01976:Bnip2 APN 9 70000834 splice site probably benign
IGL03226:Bnip2 APN 9 69996174 missense probably benign 0.00
schmalhans UTSW 9 70002111 missense probably null 1.00
R0243:Bnip2 UTSW 9 69995505 missense probably damaging 1.00
R0637:Bnip2 UTSW 9 70003673 splice site probably null
R3686:Bnip2 UTSW 9 69999150 missense probably damaging 1.00
R3687:Bnip2 UTSW 9 69999150 missense probably damaging 1.00
R4577:Bnip2 UTSW 9 69997162 missense probably benign 0.00
R4974:Bnip2 UTSW 9 70003434 missense possibly damaging 0.91
R5924:Bnip2 UTSW 9 69997162 missense probably benign 0.00
R6629:Bnip2 UTSW 9 70002111 missense probably null 1.00
R6716:Bnip2 UTSW 9 70003661 missense probably damaging 1.00
R7496:Bnip2 UTSW 9 70003404 missense probably damaging 0.96
R8415:Bnip2 UTSW 9 70003685 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAGTTTGTGATTCAAAAGCCTTTT -3'
(R):5'- ACAGGGTGAAACTACTCTACTTTAAAA -3'

Sequencing Primer
(F):5'- GGAAAGGCTCGATTACTG -3'
(R):5'- AACTCCAGTTCCAGAGGATTTGC -3'
Posted On2017-03-31