Incidental Mutation 'R5957:Fbxw13'
ID471229
Institutional Source Beutler Lab
Gene Symbol Fbxw13
Ensembl Gene ENSMUSG00000049314
Gene NameF-box and WD-40 domain protein 13
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109179227-109195975 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 109192666 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061456] [ENSMUST00000199102] [ENSMUST00000199102] [ENSMUST00000199118]
Predicted Effect probably null
Transcript: ENSMUST00000061456
SMART Domains Protein: ENSMUSP00000053786
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
FBOX 5 45 9.33e-5 SMART
SCOP:d1gxra_ 128 249 8e-7 SMART
Blast:WD40 137 176 2e-7 BLAST
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199102
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000199102
SMART Domains Protein: ENSMUSP00000142352
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
SCOP:d1gxra_ 45 166 1e-7 SMART
Blast:WD40 54 93 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199118
SMART Domains Protein: ENSMUSP00000143174
Gene: ENSMUSG00000049314

DomainStartEndE-ValueType
FBOX 5 45 3.25e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Fbxw13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Fbxw13 APN 9 109181416 missense probably damaging 0.99
IGL02455:Fbxw13 APN 9 109183187 missense probably benign 0.26
IGL03154:Fbxw13 APN 9 109181465 missense probably damaging 0.96
R0304:Fbxw13 UTSW 9 109194721 missense probably benign 0.02
R1259:Fbxw13 UTSW 9 109185371 missense probably damaging 1.00
R1710:Fbxw13 UTSW 9 109181518 missense probably damaging 1.00
R1912:Fbxw13 UTSW 9 109181543 missense probably benign 0.10
R2877:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R2878:Fbxw13 UTSW 9 109181466 missense probably damaging 1.00
R3085:Fbxw13 UTSW 9 109184231 nonsense probably null
R4321:Fbxw13 UTSW 9 109181435 missense probably benign 0.10
R4969:Fbxw13 UTSW 9 109181524 splice site probably null
R5024:Fbxw13 UTSW 9 109179335 missense probably benign 0.00
R5450:Fbxw13 UTSW 9 109184157 missense probably benign 0.41
R6801:Fbxw13 UTSW 9 109194727 missense probably null 1.00
R7448:Fbxw13 UTSW 9 109185403 missense unknown
R7710:Fbxw13 UTSW 9 109195900 missense probably damaging 1.00
R8163:Fbxw13 UTSW 9 109183054 missense probably benign 0.45
R8320:Fbxw13 UTSW 9 109183066 missense probably benign 0.02
X0065:Fbxw13 UTSW 9 109192708 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCCTGCACAGATGGCTAAG -3'
(R):5'- AACATACCTTCTTCGGTCTGAGTTG -3'

Sequencing Primer
(F):5'- AAGGGACCTGACATCCTCTTGTG -3'
(R):5'- TCGGTCTGAGTTGTCCCTC -3'
Posted On2017-03-31