Incidental Mutation 'R5957:Ccr8'
ID471231
Institutional Source Beutler Lab
Gene Symbol Ccr8
Ensembl Gene ENSMUSG00000042262
Gene Namechemokine (C-C motif) receptor 8
SynonymsCmkbr8
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120092114-120094906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120093827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 3 (Y3H)
Ref Sequence ENSEMBL: ENSMUSP00000038473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048777]
Predicted Effect probably damaging
Transcript: ENSMUST00000048777
AA Change: Y3H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: Y3H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 313 2.4e-8 PFAM
Pfam:7tm_1 50 298 3.3e-44 PFAM
low complexity region 338 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217495
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Ccr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Ccr8 APN 9 120094625 missense probably damaging 1.00
IGL02558:Ccr8 APN 9 120094658 missense probably benign 0.01
IGL02966:Ccr8 APN 9 120094140 missense probably damaging 0.96
IGL03135:Ccr8 APN 9 120094623 missense possibly damaging 0.89
R0402:Ccr8 UTSW 9 120094910 splice site probably null
R0739:Ccr8 UTSW 9 120094349 missense probably damaging 1.00
R1069:Ccr8 UTSW 9 120094217 missense probably benign 0.00
R4766:Ccr8 UTSW 9 120094464 missense probably damaging 1.00
R4934:Ccr8 UTSW 9 120094749 missense probably benign
R5116:Ccr8 UTSW 9 120094029 missense probably benign 0.39
R5942:Ccr8 UTSW 9 120094706 missense probably damaging 0.99
R5996:Ccr8 UTSW 9 120094463 missense probably damaging 1.00
R7223:Ccr8 UTSW 9 120094617 missense probably damaging 0.99
R8037:Ccr8 UTSW 9 120094370 missense probably benign
R8332:Ccr8 UTSW 9 120094374 missense probably damaging 1.00
Z1177:Ccr8 UTSW 9 120094499 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTTTGTGGATCCATAAAATGAAAGAG -3'
(R):5'- CCACGAGGACTAAGATGACCA -3'

Sequencing Primer
(F):5'- GGTGGTACAGATCTGTAATACCTCC -3'
(R):5'- GACTAAGATGACCAGGCTGTTCC -3'
Posted On2017-03-31