Mutagenetix > Incidental Mutation

Incidental Mutation 'R5957:Syde1'

471232

Institutional Source

Beutler Lab

Gene Symbol

Syde1

Ensembl Gene

ENSMUSG00000032714

Gene Name

synapse defective 1, Rho GTPase, homolog 1 (C. elegans)

Synonyms

1200008N06Rik, mSYD1A

MMRRC Submission

043246-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5957 (G1)

Quality Score

204

Status

Not validated

Chromosome

Chromosomal Location

78584503-78591964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78590117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 72 (Y72C)

Ref Sequence

ENSEMBL: ENSMUSP00000043085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040580]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000040580
AA Change: Y72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043085
Gene: ENSMUSG00000032714
AA Change: Y72C

Domain	Start	End	E-Value	Type
low complexity region	37	45	N/A	INTRINSIC
low complexity region	56	69	N/A	INTRINSIC
low complexity region	114	127	N/A	INTRINSIC
low complexity region	147	160	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	321	335	N/A	INTRINSIC
RhoGAP	411	601	1.49e-56	SMART
low complexity region	638	652	N/A	INTRINSIC
low complexity region	681	694	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218641

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Rho GTPase-activating protein highly expressed in placenta. The encoded protein is involved in cytoskeletal remodeling and trophoblast cell migration. Decreased expression of this gene has been associated with intrauterine growth restriction (IUGR). [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced miniature excitatory postsynaptic current freuqency and docked vesciles in CA1 synpases. Mice homozygous for another allele exhibit reduced embryos and placental weight with abnormal placenta morphology and placental vasculature. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,161	T1704A	probably benign	Het
Adgrg7	T	A	16: 56,773,427	N142I	probably damaging	Het
Aldh18a1	A	T	19: 40,570,537	Y286*	probably null	Het
Armc4	T	C	18: 7,285,706	E219G	probably benign	Het
Arpp21	T	C	9: 112,185,686	T17A	probably benign	Het
Atp5s	T	C	12: 69,743,784	V185A	probably benign	Het
Bnip2	T	C	9: 69,999,238	I147T	probably damaging	Het
Ccr8	T	C	9: 120,093,827	Y3H	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Cul7	G	A	17: 46,657,757	G553S	probably damaging	Het
Cyp21a1	A	G	17: 34,803,176	I206T	probably benign	Het
Dennd4b	A	G	3: 90,270,965	D488G	probably damaging	Het
Dip2b	T	C	15: 100,209,694	L1195P	probably benign	Het
Dock5	T	A	14: 67,857,994	H77L	probably benign	Het
Fbxw13	C	T	9: 109,192,666		probably null	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Gbf1	G	T	19: 46,246,221		probably null	Het
Gm12794	T	C	4: 101,941,701	F290L	probably benign	Het
Gm4846	T	C	1: 166,486,953	I374V	probably benign	Het
Gsk3b	C	A	16: 38,193,953	P258T	probably damaging	Het
Igsf5	T	C	16: 96,364,049	V8A	probably benign	Het
Il22	T	A	10: 118,205,166	L59Q	probably damaging	Het
Ildr1	T	C	16: 36,725,534	*517Q	probably null	Het
Iqca	T	A	1: 90,080,948	D450V	probably damaging	Het
Itga5	T	C	15: 103,351,429	D647G	probably benign	Het
Myh7	T	G	14: 54,989,078	N408T	probably damaging	Het
Mylk3	T	C	8: 85,328,637	M564V	probably damaging	Het
Nsd2	T	A	5: 33,855,603	M407K	probably damaging	Het
Oprd1	C	T	4: 132,144,163	V75I	probably benign	Het
Poli	G	A	18: 70,517,440	H310Y	probably benign	Het
Ptch1	C	T	13: 63,525,115	R755H	probably damaging	Het
Pygl	A	T	12: 70,199,720	M351K	probably damaging	Het
Serpinb9b	T	C	13: 33,039,848	L341P	possibly damaging	Het
Slc47a1	A	G	11: 61,344,342	V555A	probably benign	Het
Slc8a2	C	A	7: 16,145,284	T565K	possibly damaging	Het
Snx14	T	C	9: 88,403,274	I446V	possibly damaging	Het
Trim37	C	T	11: 87,145,551	R138C	probably damaging	Het
Tubgcp5	T	A	7: 55,814,962	S530R	probably benign	Het
Vps13c	T	C	9: 67,954,971	S2957P	probably damaging	Het
Wdr41	T	C	13: 94,997,187		probably null	Het
Zyg11b	T	C	4: 108,245,013	K504E	probably damaging	Het

Other mutations in Syde1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Syde1	APN	10	78585809	missense	probably damaging	1.00
IGL01285:Syde1	APN	10	78588887	missense	probably damaging	1.00
IGL01529:Syde1	APN	10	78590181	missense	probably benign
IGL01869:Syde1	APN	10	78588919	missense	possibly damaging	0.93
IGL02098:Syde1	APN	10	78589371	missense	probably damaging	1.00
IGL03187:Syde1	APN	10	78589109	missense	possibly damaging	0.79
R0014:Syde1	UTSW	10	78590034	missense	probably benign
R0561:Syde1	UTSW	10	78589376	missense	probably damaging	1.00
R0605:Syde1	UTSW	10	78589095	unclassified	probably benign
R1713:Syde1	UTSW	10	78585696	missense	probably damaging	1.00
R1756:Syde1	UTSW	10	78586980	missense	probably benign
R4491:Syde1	UTSW	10	78590228	missense	probably benign	0.00
R4846:Syde1	UTSW	10	78588897	missense	probably damaging	0.99
R5092:Syde1	UTSW	10	78589418	missense	probably benign
R5287:Syde1	UTSW	10	78590037	missense	probably benign
R5611:Syde1	UTSW	10	78585891	missense	probably benign
R5951:Syde1	UTSW	10	78589316	missense	possibly damaging	0.87
R6169:Syde1	UTSW	10	78586104	missense	probably damaging	1.00
R7083:Syde1	UTSW	10	78587069	missense	probably benign	0.44
R7150:Syde1	UTSW	10	78586198	nonsense	probably null
R7239:Syde1	UTSW	10	78588781	missense	probably damaging	1.00
R7799:Syde1	UTSW	10	78589907	missense	probably benign
R7947:Syde1	UTSW	10	78590082	missense	probably damaging	1.00
R8876:Syde1	UTSW	10	78589491	missense	probably damaging	1.00
R8946:Syde1	UTSW	10	78588849	missense	probably damaging	0.99
R9104:Syde1	UTSW	10	78585836	missense	probably benign	0.01
R9132:Syde1	UTSW	10	78589506	missense	probably benign
R9703:Syde1	UTSW	10	78585723	missense	probably damaging	1.00
R9728:Syde1	UTSW	10	78588804	frame shift	probably null
Z1176:Syde1	UTSW	10	78586131	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CTTCTGGCTCAGAGGAAGCTAG -3'
(R):5'- CCAATTAGCTAGACTGCCTCC -3'

Sequencing Primer
(F):5'- CTCAGAGGAAGCTAGCTGTGATCC -3'
(R):5'- CCTGGACCTCTGGGAACTTGAG -3'

Posted On

2017-03-31