Incidental Mutation 'R5957:Trim37'
ID 471236
Institutional Source Beutler Lab
Gene Symbol Trim37
Ensembl Gene ENSMUSG00000018548
Gene Name tripartite motif-containing 37
Synonyms MUL, 1110032A10Rik, 2810004E07Rik, TEF3
MMRRC Submission 043246-MU
Accession Numbers

Genbank: NM_197987
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5957 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 87127077-87220683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 87145551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 138 (R138C)
Ref Sequence ENSEMBL: ENSMUSP00000119269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041282] [ENSMUST00000139532]
AlphaFold Q6PCX9
Predicted Effect probably damaging
Transcript: ENSMUST00000041282
AA Change: R153C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548
AA Change: R153C

DomainStartEndE-ValueType
RING 15 54 1.71e-1 SMART
BBOX 90 132 7.32e-12 SMART
BBC 132 254 3.05e-31 SMART
MATH 281 384 1.51e-13 SMART
low complexity region 494 504 N/A INTRINSIC
low complexity region 516 529 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139532
AA Change: R138C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119269
Gene: ENSMUSG00000018548
AA Change: R138C

DomainStartEndE-ValueType
BBOX 75 117 7.32e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Gene trapped(7)
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Trim37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Trim37 APN 11 87186393 missense probably damaging 1.00
IGL01372:Trim37 APN 11 87184946 missense probably benign 0.00
IGL01510:Trim37 APN 11 87177860 missense probably damaging 1.00
IGL02055:Trim37 APN 11 87166649 missense probably benign 0.44
IGL02106:Trim37 APN 11 87201404 nonsense probably null
IGL02251:Trim37 APN 11 87167430 splice site probably benign
IGL02498:Trim37 APN 11 87185050 missense probably benign
IGL02836:Trim37 APN 11 87196959 missense probably benign 0.01
IGL03089:Trim37 APN 11 87190137 missense probably damaging 1.00
IGL03302:Trim37 APN 11 87147001 missense possibly damaging 0.89
IGL03347:Trim37 APN 11 87201621 missense possibly damaging 0.80
G5030:Trim37 UTSW 11 87143141 missense probably damaging 0.96
R0396:Trim37 UTSW 11 87146968 missense probably damaging 1.00
R0544:Trim37 UTSW 11 87145502 nonsense probably null
R0946:Trim37 UTSW 11 87146955 missense probably damaging 0.99
R1481:Trim37 UTSW 11 87129759 nonsense probably null
R1799:Trim37 UTSW 11 87178019 missense probably damaging 1.00
R1851:Trim37 UTSW 11 87218306 missense probably damaging 1.00
R2107:Trim37 UTSW 11 87159825 missense probably benign 0.04
R3878:Trim37 UTSW 11 87206002 missense probably benign 0.10
R4049:Trim37 UTSW 11 87140603 critical splice donor site probably null
R4224:Trim37 UTSW 11 87216463 missense probably damaging 1.00
R4486:Trim37 UTSW 11 87196825 missense probably benign 0.31
R5244:Trim37 UTSW 11 87218257 missense probably benign 0.10
R5343:Trim37 UTSW 11 87137603 missense probably damaging 0.98
R5417:Trim37 UTSW 11 87166679 missense probably damaging 1.00
R5894:Trim37 UTSW 11 87201440 missense probably damaging 0.99
R5911:Trim37 UTSW 11 87196837 nonsense probably null
R6159:Trim37 UTSW 11 87216548 critical splice donor site probably null
R6479:Trim37 UTSW 11 87216487 nonsense probably null
R6527:Trim37 UTSW 11 87190084 missense probably damaging 1.00
R7021:Trim37 UTSW 11 87167509 missense probably benign 0.01
R7734:Trim37 UTSW 11 87177995 missense probably damaging 1.00
R7849:Trim37 UTSW 11 87201444 missense possibly damaging 0.87
R7938:Trim37 UTSW 11 87147037 missense probably benign 0.05
R7968:Trim37 UTSW 11 87149353 missense possibly damaging 0.47
R8046:Trim37 UTSW 11 87146968 missense possibly damaging 0.89
R8112:Trim37 UTSW 11 87218267 missense possibly damaging 0.80
R8735:Trim37 UTSW 11 87147059 critical splice donor site probably null
R8770:Trim37 UTSW 11 87159849 missense probably damaging 1.00
R8911:Trim37 UTSW 11 87206803 missense possibly damaging 0.89
R9234:Trim37 UTSW 11 87145567 missense possibly damaging 0.95
R9332:Trim37 UTSW 11 87167502 missense possibly damaging 0.94
R9346:Trim37 UTSW 11 87166600 critical splice acceptor site probably null
R9431:Trim37 UTSW 11 87186431 missense probably benign 0.34
Z1177:Trim37 UTSW 11 87185043 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGGCCCTGTTTTAAGAAG -3'
(R):5'- AGTGCTCTGGGTGTAAATTTCTCTAC -3'

Sequencing Primer
(F):5'- CTGGCCCTGTTTTAAGAAGATAAAGG -3'
(R):5'- CTACTTTTTGATGCTAAGACTTGAGG -3'
Posted On 2017-03-31