Incidental Mutation 'R5957:Atp5s'
ID471238
Institutional Source Beutler Lab
Gene Symbol Atp5s
Ensembl Gene ENSMUSG00000054894
Gene NameATP synthase, H+ transporting, mitochondrial F0 complex, subunit S
Synonyms1110015E18Rik, facyor B
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69724950-69744660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69743784 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000152430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021372] [ENSMUST00000021377] [ENSMUST00000220460] [ENSMUST00000220539] [ENSMUST00000220916]
Predicted Effect probably benign
Transcript: ENSMUST00000021372
AA Change: V185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894
AA Change: V185A

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000021377
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220460
Predicted Effect probably benign
Transcript: ENSMUST00000220539
Predicted Effect probably benign
Transcript: ENSMUST00000220916
AA Change: V185A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. This gene encodes the subunit s, also known as factor B, of the proton channel. This subunit is necessary for the energy transduction activity of the ATP synthase complexes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Pygl A T 12: 70,199,720 M351K probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Atp5s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02513:Atp5s APN 12 69741045 missense probably benign 0.00
R0344:Atp5s UTSW 12 69740889 unclassified probably benign
R0848:Atp5s UTSW 12 69741810 missense probably benign 0.30
R1236:Atp5s UTSW 12 69741818 critical splice donor site probably null
R1539:Atp5s UTSW 12 69741071 missense probably benign 0.04
R2143:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R2144:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R2145:Atp5s UTSW 12 69741054 missense probably damaging 0.97
R7157:Atp5s UTSW 12 69741788 missense probably benign 0.06
R7257:Atp5s UTSW 12 69741669 missense probably damaging 1.00
Z1177:Atp5s UTSW 12 69740962 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGACTGTTGCTCTGAGAAGC -3'
(R):5'- ACAGTAACATGCTTCAATGTGGTG -3'

Sequencing Primer
(F):5'- ACTGTTGCTCTGAGAAGCCATTG -3'
(R):5'- TGCATTGCAGTTTAAAGAACTCTAC -3'
Posted On2017-03-31