Mutagenetix > Incidental Mutation

Incidental Mutation 'R5957:Pygl'

471239

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

043246-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R5957 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70199720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 351 (M351K)

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably damaging
Transcript: ENSMUST00000071250
AA Change: M442K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: M442K

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000161083
AA Change: M351K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: M351K

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162613

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222093

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,070,161	T1704A	probably benign	Het
Adgrg7	T	A	16: 56,773,427	N142I	probably damaging	Het
Aldh18a1	A	T	19: 40,570,537	Y286*	probably null	Het
Armc4	T	C	18: 7,285,706	E219G	probably benign	Het
Arpp21	T	C	9: 112,185,686	T17A	probably benign	Het
Atp5s	T	C	12: 69,743,784	V185A	probably benign	Het
Bnip2	T	C	9: 69,999,238	I147T	probably damaging	Het
Ccr8	T	C	9: 120,093,827	Y3H	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Cul7	G	A	17: 46,657,757	G553S	probably damaging	Het
Cyp21a1	A	G	17: 34,803,176	I206T	probably benign	Het
Dennd4b	A	G	3: 90,270,965	D488G	probably damaging	Het
Dip2b	T	C	15: 100,209,694	L1195P	probably benign	Het
Dock5	T	A	14: 67,857,994	H77L	probably benign	Het
Fbxw13	C	T	9: 109,192,666		probably null	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Gbf1	G	T	19: 46,246,221		probably null	Het
Gm12794	T	C	4: 101,941,701	F290L	probably benign	Het
Gm4846	T	C	1: 166,486,953	I374V	probably benign	Het
Gsk3b	C	A	16: 38,193,953	P258T	probably damaging	Het
Igsf5	T	C	16: 96,364,049	V8A	probably benign	Het
Il22	T	A	10: 118,205,166	L59Q	probably damaging	Het
Ildr1	T	C	16: 36,725,534	*517Q	probably null	Het
Iqca	T	A	1: 90,080,948	D450V	probably damaging	Het
Itga5	T	C	15: 103,351,429	D647G	probably benign	Het
Myh7	T	G	14: 54,989,078	N408T	probably damaging	Het
Mylk3	T	C	8: 85,328,637	M564V	probably damaging	Het
Nsd2	T	A	5: 33,855,603	M407K	probably damaging	Het
Oprd1	C	T	4: 132,144,163	V75I	probably benign	Het
Poli	G	A	18: 70,517,440	H310Y	probably benign	Het
Ptch1	C	T	13: 63,525,115	R755H	probably damaging	Het
Serpinb9b	T	C	13: 33,039,848	L341P	possibly damaging	Het
Slc47a1	A	G	11: 61,344,342	V555A	probably benign	Het
Slc8a2	C	A	7: 16,145,284	T565K	possibly damaging	Het
Snx14	T	C	9: 88,403,274	I446V	possibly damaging	Het
Syde1	T	C	10: 78,590,117	Y72C	probably damaging	Het
Trim37	C	T	11: 87,145,551	R138C	probably damaging	Het
Tubgcp5	T	A	7: 55,814,962	S530R	probably benign	Het
Vps13c	T	C	9: 67,954,971	S2957P	probably damaging	Het
Wdr41	T	C	13: 94,997,187		probably null	Het
Zyg11b	T	C	4: 108,245,013	K504E	probably damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGGCCCTTTCATGGAAAGC -3'
(R):5'- GCTTCTCCACATGTAGCTGG -3'

Sequencing Primer
(F):5'- TTCATGGAAAGCACACCCTGTTG -3'
(R):5'- CCACATGTAGCTGGCTCTAC -3'

Posted On

2017-03-31