Incidental Mutation 'R5957:Pygl'
ID471239
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Nameliver glycogen phosphorylase
Synonyms
MMRRC Submission 043246-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R5957 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70190811-70231488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70199720 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 351 (M351K)
Ref Sequence ENSEMBL: ENSMUSP00000125585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
Predicted Effect probably damaging
Transcript: ENSMUST00000071250
AA Change: M442K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: M442K

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161083
AA Change: M351K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: M351K

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222093
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,161 T1704A probably benign Het
Adgrg7 T A 16: 56,773,427 N142I probably damaging Het
Aldh18a1 A T 19: 40,570,537 Y286* probably null Het
Armc4 T C 18: 7,285,706 E219G probably benign Het
Arpp21 T C 9: 112,185,686 T17A probably benign Het
Atp5s T C 12: 69,743,784 V185A probably benign Het
Bnip2 T C 9: 69,999,238 I147T probably damaging Het
Ccr8 T C 9: 120,093,827 Y3H probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Cul7 G A 17: 46,657,757 G553S probably damaging Het
Cyp21a1 A G 17: 34,803,176 I206T probably benign Het
Dennd4b A G 3: 90,270,965 D488G probably damaging Het
Dip2b T C 15: 100,209,694 L1195P probably benign Het
Dock5 T A 14: 67,857,994 H77L probably benign Het
Fbxw13 C T 9: 109,192,666 probably null Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Gbf1 G T 19: 46,246,221 probably null Het
Gm12794 T C 4: 101,941,701 F290L probably benign Het
Gm4846 T C 1: 166,486,953 I374V probably benign Het
Gsk3b C A 16: 38,193,953 P258T probably damaging Het
Igsf5 T C 16: 96,364,049 V8A probably benign Het
Il22 T A 10: 118,205,166 L59Q probably damaging Het
Ildr1 T C 16: 36,725,534 *517Q probably null Het
Iqca T A 1: 90,080,948 D450V probably damaging Het
Itga5 T C 15: 103,351,429 D647G probably benign Het
Myh7 T G 14: 54,989,078 N408T probably damaging Het
Mylk3 T C 8: 85,328,637 M564V probably damaging Het
Nsd2 T A 5: 33,855,603 M407K probably damaging Het
Oprd1 C T 4: 132,144,163 V75I probably benign Het
Poli G A 18: 70,517,440 H310Y probably benign Het
Ptch1 C T 13: 63,525,115 R755H probably damaging Het
Serpinb9b T C 13: 33,039,848 L341P possibly damaging Het
Slc47a1 A G 11: 61,344,342 V555A probably benign Het
Slc8a2 C A 7: 16,145,284 T565K possibly damaging Het
Snx14 T C 9: 88,403,274 I446V possibly damaging Het
Syde1 T C 10: 78,590,117 Y72C probably damaging Het
Trim37 C T 11: 87,145,551 R138C probably damaging Het
Tubgcp5 T A 7: 55,814,962 S530R probably benign Het
Vps13c T C 9: 67,954,971 S2957P probably damaging Het
Wdr41 T C 13: 94,997,187 probably null Het
Zyg11b T C 4: 108,245,013 K504E probably damaging Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70191092 missense probably damaging 1.00
IGL00903:Pygl APN 12 70207742 missense probably damaging 1.00
IGL01965:Pygl APN 12 70191114 missense probably benign 0.00
IGL02347:Pygl APN 12 70201892 missense probably benign 0.14
IGL02403:Pygl APN 12 70194258 missense probably benign
IGL02501:Pygl APN 12 70191134 missense probably benign 0.05
IGL02727:Pygl APN 12 70207668 splice site probably null
IGL03125:Pygl APN 12 70197482 missense probably damaging 1.00
IGL03158:Pygl APN 12 70195675 missense probably damaging 1.00
IGL03202:Pygl APN 12 70199646 missense probably benign
IGL03368:Pygl APN 12 70191152 missense probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0096:Pygl UTSW 12 70191166 splice site probably benign
R0524:Pygl UTSW 12 70207724 missense probably damaging 1.00
R0883:Pygl UTSW 12 70206404 missense probably damaging 0.97
R0894:Pygl UTSW 12 70194374 splice site probably benign
R0905:Pygl UTSW 12 70211017 splice site probably benign
R1494:Pygl UTSW 12 70199730 missense probably damaging 0.98
R1621:Pygl UTSW 12 70191092 missense probably damaging 1.00
R1647:Pygl UTSW 12 70197010 missense possibly damaging 0.60
R3082:Pygl UTSW 12 70197529 missense probably damaging 1.00
R3845:Pygl UTSW 12 70198443 missense probably benign 0.12
R3876:Pygl UTSW 12 70201339 missense probably damaging 1.00
R4358:Pygl UTSW 12 70195690 missense probably damaging 1.00
R4614:Pygl UTSW 12 70210979 splice site probably null
R4707:Pygl UTSW 12 70207758 missense possibly damaging 0.69
R4908:Pygl UTSW 12 70197033 missense probably null
R4940:Pygl UTSW 12 70206381 missense probably damaging 1.00
R5077:Pygl UTSW 12 70201892 missense probably benign 0.14
R5186:Pygl UTSW 12 70201344 missense probably damaging 1.00
R5726:Pygl UTSW 12 70191142 nonsense probably null
R5953:Pygl UTSW 12 70219627 missense probably damaging 1.00
R6020:Pygl UTSW 12 70216654 missense probably damaging 1.00
R6024:Pygl UTSW 12 70197067 missense probably benign 0.09
R7050:Pygl UTSW 12 70219622 missense probably damaging 1.00
R7159:Pygl UTSW 12 70197406 missense probably benign 0.41
R7194:Pygl UTSW 12 70194320 missense probably benign
R7283:Pygl UTSW 12 70216568 missense possibly damaging 0.92
R7360:Pygl UTSW 12 70227532 missense probably benign 0.11
R7446:Pygl UTSW 12 70197010 missense probably benign
R7637:Pygl UTSW 12 70197795 splice site probably null
R7886:Pygl UTSW 12 70206356 splice site probably null
R8054:Pygl UTSW 12 70227339 critical splice donor site probably null
Z1176:Pygl UTSW 12 70222874 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGCCCTTTCATGGAAAGC -3'
(R):5'- GCTTCTCCACATGTAGCTGG -3'

Sequencing Primer
(F):5'- TTCATGGAAAGCACACCCTGTTG -3'
(R):5'- CCACATGTAGCTGGCTCTAC -3'
Posted On2017-03-31